Entry information : MguPrx48 (mgv1a010234m)
Entry ID 9217
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx48 (mgv1a010234m)
Name (synonym) MguPrx48 (mgv1a010234m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx48
start..stop
S start..stop
MguPrx46 594 0 1..318 1..318
MguPrx47 588 0 1..318 1..318
SbaPrx03 505 0 1..318 1..318
CroPrx31 444 1e-158 7..318 10..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2327827..2328039 213 N° 2 2327140..2327497 358 N° 3 2326652..2327034 383  
complement(join(2326652..2327034,2327140..2327497,2327827..2328039))


exon

Literature and cross-references MguPrx48 (mgv1a010234m)
DNA ref. Phytozome 12:   scaffold_13 (2328039..2326652)
Protein sequence: MguPrx48 (mgv1a010234m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   33719.87 (31270.6) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.21 (9.17) Peptide Signal:   %s   cut: 25 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTSTCVLSARLMFVLVLIGAANAQLSPNFYSTRCPNLLTIVRTAVNTAVANDRRMGASLLRLHFHDCFVQGCDGSVLLDDVAGFTGEKTAAPNANSLRGFDVIDTIKTRVEAACPGIVSCADILTIAARDGTVAVSGPSWALSLGRRDSTTASLNGANSQLPGPGSSLNNLITSFANKGFTTREMVALSGSHTIGLARCSTFRNRIYNAANIDPAFATARRANCPRTGGDNNLAPLDTVSSNTFNNDYYTNLVSRRGLLTSDQVLFNNGTTDAQVRAYSTNSASFFNDFAAAMVKMSNLSPLTGTNGQIRRNCRRR

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTACTTCTACTTGTGTTTTATCGGCTCGATTAATGTTCGTTCTTGTTCTAATTGGAGCAGCCAATGCGCAGTTATCTCCCAATTTCTATAGTACAAGATGCCCTAATCTTCTTACT
ATTGTCAGAACAGCTGTCAATACAGCTGTGGCCAATGACCGTCGTATGGGCGCCTCTTTGCTTCGTCTCCATTTCCACGATTGTTTTGTGCAG
GTAATATAATTAATTAGTTTCCTTCGT
CAAAACATAATTATGAATTGATTTGCATTTTGATTATGTACTACACAACTTAATGACATGCATGCTCCGATATATATCTTTGTCTGTTCATCATGCCGCCGGATCGGATTTATATTGATT
CTTAAATCTTATTTTTTCTTTTAATTCATTTTTTTTTTCATTTTGTCATACACTATATATATATATAGTAAATTGTATTGATAGCTAGTGGACCAACTTTAACTTTTATAATATTTTTTA
CATGTAATTAATGATTGGTATCTAAACTTTAAAATAATACATTATACATTGTATGCACACAGGGATGCGATGGATCGGTATTATTGGATGACGTAGCAGGTTTCACCGGAGAAAAGACCG
CCGCTCCGAACGCCAACTCATTGAGAGGGTTCGATGTCATCGACACCATCAAAACCAGGGTCGAGGCCGCCTGCCCGGGCATCGTTTCATGCGCCGATATTCTGACCATCGCTGCCCGTG
ACGGGACCGTTGCTGTCAGCGGTCCTAGTTGGGCGCTTTCACTCGGAAGAAGAGACTCAACCACCGCGAGTTTGAACGGCGCAAATAGTCAACTCCCCGGACCCGGATCCAGTCTCAACA
ACCTTATTACTTCATTCGCCAACAAAGGCTTCACTACTAGGGAAATGGTTGCCCTTTCTG
GTAATTATAATATTTCATTACTTAATTAGTTTCCAACCAAATTAATTTAATGATAGTNNN
NNNNNNNNNNNNNNNNNNNNNNNTTTGTATTTTTGTAATTATTAGGATCGCACACAATAGGATTGGCGAGGTGCAGTACTTTCAGGAACAGAATCTACAACGCCGCGAACATAGATCCCG
CCTTCGCAACCGCAAGGAGGGCAAACTGTCCGAGAACCGGCGGAGACAACAACCTGGCGCCGCTCGACACCGTCAGCTCCAACACATTCAACAACGACTACTACACGAATTTGGTGAGCC
GAAGGGGTCTCCTCACTTCCGACCAGGTACTATTCAACAATGGAACCACAGACGCGCAGGTGAGAGCGTACAGTACAAACTCGGCTTCTTTCTTCAACGACTTCGCCGCTGCTATGGTTA
AGATGTCGAATCTCTCCCCACTCACCGGGACCAATGGTCAGATCAGGAGAAACTGCAGACGTAGAAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTACTTCTACTTGTGTTTTATCGGCTCGATTAATGTTCGTTCTTGTTCTAATTGGAGCAGCCAATGCGCAGTTATCTCCCAATTTCTATAGTACAAGATGCCCTAATCTTCTTACT
ATTGTCAGAACAGCTGTCAATACAGCTGTGGCCAATGACCGTCGTATGGGCGCCTCTTTGCTTCGTCTCCATTTCCACGATTGTTTTGTGCAG
GGATGCGATGGATCGGTATTATTGGAT
GACGTAGCAGGTTTCACCGGAGAAAAGACCGCCGCTCCGAACGCCAACTCATTGAGAGGGTTCGATGTCATCGACACCATCAAAACCAGGGTCGAGGCCGCCTGCCCGGGCATCGTTTCA
TGCGCCGATATTCTGACCATCGCTGCCCGTGACGGGACCGTTGCTGTCAGCGGTCCTAGTTGGGCGCTTTCACTCGGAAGAAGAGACTCAACCACCGCGAGTTTGAACGGCGCAAATAGT
CAACTCCCCGGACCCGGATCCAGTCTCAACAACCTTATTACTTCATTCGCCAACAAAGGCTTCACTACTAGGGAAATGGTTGCCCTTTCTG
GATCGCACACAATAGGATTGGCGAGGTGC
AGTACTTTCAGGAACAGAATCTACAACGCCGCGAACATAGATCCCGCCTTCGCAACCGCAAGGAGGGCAAACTGTCCGAGAACCGGCGGAGACAACAACCTGGCGCCGCTCGACACCGTC
AGCTCCAACACATTCAACAACGACTACTACACGAATTTGGTGAGCCGAAGGGGTCTCCTCACTTCCGACCAGGTACTATTCAACAATGGAACCACAGACGCGCAGGTGAGAGCGTACAGT
ACAAACTCGGCTTCTTTCTTCAACGACTTCGCCGCTGCTATGGTTAAGATGTCGAATCTCTCCCCACTCACCGGGACCAATGGTCAGATCAGGAGAAACTGCAGACGTAGAAAC

Retrieve as FASTA