Entry information : MguPrx49 (mgv1a010308m)
Entry ID 9218
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx49 (mgv1a010308m)
Name (synonym) MguPrx49 (mgv1a010308m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx49
start..stop
S start..stop
GhPrx23 513 0 3..316 4..317
SaPrx13 513 0 1..316 1..324
PpePrx30 503 0 1..316 5..318
CroPrx21 502 0 1..316 1..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1867242..1867445 204 N° 2 1866940..1867128 189 N° 3 1866619..1866781 163 N° 4 1866143..1866534 392
complement(join(1866143..1866534,1866619..1866781,1866940..1867128,1867242..1867 445))


exon

Literature and cross-references MguPrx49 (mgv1a010308m)
DNA ref. Phytozome 12:   scaffold_30 (1867445..1866143)
Protein sequence: MguPrx49 (mgv1a010308m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (294)
PWM (Da):   %s   33591.86 (31361.8)  
PI (pH):   %s   8.55 (8.73) Peptide Signal:   %s   cut: 23 range:23-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGFIVALILCSIVSSFCSSANSLSLNYYSKTCSNVDSIISKVVKDATSKDNTVPAALLRLHFHDCFIRGCDGSVLLESNGGNKAEKDGAPNLSLHAFFVIENAKKAVEAACPGIVSCADILALAARDSVVLAGGPTWEVPKGRKDGRTSKATETAKLPSPAFNISQLQQSFSLRGLSTDDLVALSGGHTLGFSHCSSFEKRIHNFNSTHDVDPTMHPSFAASLKNICPVNNNVKNAGATMDPSSTTFDNTYYKLILQGKTLFSSDQALLTAPYTKNLVSKFASSKTAFYTAFANSMIKMSSINGGQEVRKDCRAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATTCATAGTAGCATTAATATTATGCTCAATAGTCTCATCATTTTGTTCATCAGCAAATTCACTGAGTCTGAATTATTACAGCAAAACATGTTCGAACGTCGACTCCATTATCAGC
AAAGTCGTTAAGGATGCAACATCGAAAGACAATACCGTCCCTGCAGCGCTTCTCAGGCTACATTTCCATGATTGCTTCATAAGG
GTAAGCATTATCTGTTTATGTATTTCATCTTAATTT
AGTAACTAACTCATCATGATTGTATTTATTTTATCGATGATTTGATTATGTGTTATGTATACGAGAAAAAAAAATAGGGGTGCGATGGTTCGGTGTTGCTGGAGTCCAACGGTGGTAACA
AAGCAGAAAAAGACGGAGCTCCGAATCTTTCTCTGCATGCGTTTTTCGTGATAGAAAATGCAAAGAAGGCAGTCGAAGCTGCTTGCCCGGGCATCGTCTCCTGTGCTGATATCTTGGCCT
TGGCTGCTAGAGATTCTGTTGTCCTA
GTAAGNNNNNNNNNNNNNNNNNNNNNGTGTGTGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNAATGAAGCGTAATTTGAAACGGATATCGTGGGTGGTGATGTATAGGCTGGTGGGCCGACATGGGAAGTTCCGAAAGGAAGAAAAGATGGACGAACATCAAA
AGCCACCGAAACCGCAAAATTGCCATCTCCAGCTTTCAACATTTCTCAACTTCAACAAAGCTTCTCTCTACGAGGCCTCTCAACGGATGACCTCGTGGCTCTTTCAG
GTCAGCAAATAAC
CGAATTACAATTTTCACCATGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTTGTTTATGCATGCAGGTGGGCACACACTAGGGTTCTCGCACTGCTCGTCGTTCGAGAAAAGGAT
CCACAACTTCAACTCGACCCACGATGTGGACCCCACCATGCACCCGTCGTTTGCAGCGAGCTTGAAAAATATCTGCCCCGTTAATAACAACGTCAAGAACGCTGGCGCCACCATGGACCC
TTCTTCTACGACGTTCGACAACACATACTACAAACTTATACTCCAAGGCAAAACCCTATTTTCATCGGATCAAGCTCTACTCACCGCTCCATACACGAAAAACTTGGTTTCTAAATTCGC
CAGCTCCAAAACGGCTTTCTACACTGCCTTTGCAAACTCGATGATTAAGATGAGCAGCATCAATGGAGGGCAGGAGGTCAGGAAGGATTGTAGGGCTGTAAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATTCATAGTAGCATTAATATTATGCTCAATAGTCTCATCATTTTGTTCATCAGCAAATTCACTGAGTCTGAATTATTACAGCAAAACATGTTCGAACGTCGACTCCATTATCAGC
AAAGTCGTTAAGGATGCAACATCGAAAGACAATACCGTCCCTGCAGCGCTTCTCAGGCTACATTTCCATGATTGCTTCATAAGG
GGGTGCGATGGTTCGGTGTTGCTGGAGTCCAACGGT
GGTAACAAAGCAGAAAAAGACGGAGCTCCGAATCTTTCTCTGCATGCGTTTTTCGTGATAGAAAATGCAAAGAAGGCAGTCGAAGCTGCTTGCCCGGGCATCGTCTCCTGTGCTGATATC
TTGGCCTTGGCTGCTAGAGATTCTGTTGTCCTA
GCTGGTGGGCCGACATGGGAAGTTCCGAAAGGAAGAAAAGATGGACGAACATCAAAAGCCACCGAAACCGCAAAATTGCCATCTCCA
GCTTTCAACATTTCTCAACTTCAACAAAGCTTCTCTCTACGAGGCCTCTCAACGGATGACCTCGTGGCTCTTTCAG
GTGGGCACACACTAGGGTTCTCGCACTGCTCGTCGTTCGAGAAA
AGGATCCACAACTTCAACTCGACCCACGATGTGGACCCCACCATGCACCCGTCGTTTGCAGCGAGCTTGAAAAATATCTGCCCCGTTAATAACAACGTCAAGAACGCTGGCGCCACCATG
GACCCTTCTTCTACGACGTTCGACAACACATACTACAAACTTATACTCCAAGGCAAAACCCTATTTTCATCGGATCAAGCTCTACTCACCGCTCCATACACGAAAAACTTGGTTTCTAAA
TTCGCCAGCTCCAAAACGGCTTTCTACACTGCCTTTGCAAACTCGATGATTAAGATGAGCAGCATCAATGGAGGGCAGGAGGTCAGGAAGGATTGTAGGGCTGTAAAC

Retrieve as FASTA