Entry information : SbRboh08 (Sobic.008G118700.1 [2.1] / Sb08g017240 [1.4])
Entry ID 922
Creation 2008-11-15 (Christophe Dunand)
Last sequence changes 2008-11-15 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-06 (Messaoudi)
Peroxidase information: SbRboh08 (Sobic.008G118700.1 [2.1] / Sb08g017240 [1.4])
Name (synonym) SbRboh08 (Sobic.008G118700.1 [2.1] / Sb08g017240 [1.4])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Cell culture
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh08
start..stop
S start..stop
ZmRboh10 1617 0 13..916 16..891
OsRboh09 1364 0 36..916 36..909
OsRboh01 1155 0 30..916 41..905
EcamRboh04 1144 0 31..916 37..889
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45760014..45760596 583 N° 2 45760752..45760911 160 N° 3 45761022..45761070 49 N° 4 45761182..45761295 114
N° 5 45761390..45762214 825 N° 6 45762315..45762529 215 N° 7 45762647..45763451 805  
join(45760014..45760596,45760752..45760911,45761022..45761070,45761182..45761295 ,45761390..45762214,45762315..45762529,45762647..45763451)


exon

Literature and cross-references SbRboh08 (Sobic.008G118700.1 [2.1] / Sb08g017240 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_8 (45760014..45763451)
Cluster/Prediction ref. UniGene:   Sbi.2642
Protein sequence: SbRboh08 (Sobic.008G118700.1 [2.1] / Sb08g017240 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   916
PWM (Da):   %s   101552.82 Transmb domain:   %s   o364-386i497-519o547-569i735-752o
PI (pH):   %s   8.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSSGQQHETGPPPPTAFKSASTDGKSGSRRSTRFKDEDEYVEVTLDVRDDGGGDVAVRAIKDVVLAGGPGVLGDAQDATALLDPPPTGSAAAAASGGLSSKLRAARAHLGRIASVKRAAVPLSALLRRDRDRDRDRSSRLDRSVVTGAASALRGLQFLNQAAVTEGWTEVEKRFQRLAVDGFLLRSRFGQCIGMVGSEEFAAQIFDALARRRGITAMVLTKDQVREFWEQLSDPGFDAKLQTFFDMVDKNADGQITEEELKVLTLTASANKLSKILERVDEYTALIMEELDPDNLGYIELANLESLLLQPAPASTSTRLVTHSSNNISQLISQRLAPARDDSALRRAAMAFLYFMEDNWKRVWVMSLWLAINAALFAWKFAAYRRHPTFDVMGYCVCVAKGGAETTKFNMALILLPVCRNTITWLRSRTRLGAAVPFNDNINFHKVVAGGVAVGVALHAVTHLTCDFPRLLHASAAAYEPMKAYFGQRRIPDYWWFVRGVEGVTGVIMVVLMAVAYTLAHPWFRRGKLSEGNPLRRLSGFNMFWYSHHLFVIVYVAFVVHGVCLYINRTWYKQTTWMYLAIPILLYAGERLFRALRSHGLTTVRIEKVALYPGNVIAIHMSKPHGFSYKSGQYIYVNCGEVSPFEWHPFTITSAPGDDYLSMHIRCRGDWTTSFRALFAQVCRPPAAGQSGLLRADFASSTAAASAGGGKLPKLLIDGPYGAPAQDYRKYDVLLLIGLGIGATPLISIVKDVLNNISDDDEEQPSSSSSAAAEFMTRRVYFYWCTREEGSFEWFRGVMNEVAERDARGDVVELHNHCTSVYEEGDARSALLVMLQALHHAKSGVDVVSGTRVRTHFARPNWRDVFKRVACNHQGQRVGVFYCGDQKVTPELRRLSQDFSHKTTTKFVFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 7 introns) and 3 ESTs + CD226605.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCATCGTCGGGCCAGCAGCACGAGACCGGACCGCCGCCGCCGACGGCGTTCAAGAGCGCGTCCACGGACGGCAAGAGCGGTAGCCGCCGGAGCACGCGGTTCAAGGACGAGGAC
GAGTACGTCGAGGTCACGCTCGACGTCCGCGACGACGGCGGCGGCGACGTCGCCGTCCGGGCCATCAAGGACGTCGTCCTTGCCGGCGGCCCCGGCGTCTTGGGCGACGCGCAGGACGCC
ACGGCGCTCCTGGACCCCCCACCCACCGGCTCTGCTGCTGCTGCTGCCTCGGGGGGCCTGTCGTCCAAGCTCAGGGCCGCGCGGGCGCACCTCGGTCGCATCGCCTCGGTCAAGCGCGCC
GCCGTGCCGCTCTCGGCGCTGCTCCGCCGCGACCGCGACCGGGACCGGGACCGCTCCAGCAGGCTCGACAGGAGCGTCGTCACGGGCGCCGCCAGCGCGCTCAGGGGCCTCCAGTTCCTC
AACCAGGCCGCCGTCACCGAGGGGTGGACCGAGGTGGAGAAGCGCTTCCAGCGCCTCGCCGTCGACGGTTTCCTCCTCCGCTCACGCTTCGGACAGTGCATTG
GTCAGTCACTCTTGTTT
CTTGCGTTTCCCTCTCAACTGCTTTTTTCTCAACCATTTGGTTTTGCTGTATACTAGTACTACAAGGGAAAAAAGAACTCGGAACATGTCTGAAACTCTGAATTTCTGAATGAAATGTTC
ATGTTGCACTGACTGCAGGCATGGTTGGATCCGAGGAGTTTGCCGCGCAGATCTTCGACGCACTTGCACGGCGAAGGGGCATCACAGCCATGGTGCTCACCAAGGATCAGGTCCGGGAGT
TCTGGGAGCAGCTCTCTGATCCTGGATTCGATGCCAAGCTTCAGACCTTCTTTGACAT
GTATGTCATGGGTTTAATAATCCTGTGTGCTAGTAGCAAAGTGCATTCTGATACCACTTTCA
GAAAAGTCTGTTCATGTCTGAACTAGCTTGATTGTCAACTTGTTGCAGGGTTGACAAGAATGCTGATGGTCAGATCACTGAAGAGGAGCTCAAAGAGGTAATGAAACTAGTCCATGAAAT
AGATCAATTCAATGGTTACAAACATCGATTGTCTCACTAGTTGCTCAATTCAGCTAACAACAATCTGAACTTCTTGCACCATCATCAGGTCCTCACTTTGACCGCCTCTGCCAACAAGCT
GTCCAAGATCCTGGAGCGCGTCGACGAGTACACCGCGCTGATCATGGAGGAGCTCGATCCCGACAACCTCGGCTACATCGAG
GTTCACACTCTTGCTCAATTCTGCATCAGCTTGACACT
GTTCATCTTCTTCTCACATTAACATCTGAACACAAACAAACAAACAAACGAAACAGCTCGCGAACCTGGAGTCGCTGCTGCTGCAGCCGGCGCCGGCGTCGACGTCGACGAGGCTGGTGA
CGCACAGCTCCAACAACATCAGCCAGCTGATCAGCCAGAGGCTGGCGCCGGCGCGCGACGACAGCGCGCTCCGCCGCGCCGCCATGGCATTCCTCTACTTCATGGAGGACAACTGGAAGC
GCGTGTGGGTGATGTCGCTGTGGCTGGCCATCAACGCGGCGCTCTTCGCCTGGAAGTTCGCCGCGTACCGCCGCCACCCGACGTTCGACGTGATGGGCTACTGCGTCTGCGTCGCCAAGG
GCGGCGCCGAGACCACCAAGTTCAACATGGCGCTCATCCTGCTCCCCGTCTGCCGGAACACCATCACCTGGCTCCGGTCCCGGACAAGACTCGGCGCCGCCGTCCCGTTCAACGACAACA
TCAACTTCCACAAGGTGGTGGCCGGGGGCGTCGCCGTCGGCGTCGCGCTGCACGCTGTGACGCACCTCACGTGCGACTTCCCGAGGCTGCTGCACGCCAGCGCCGCCGCGTACGAGCCCA
TGAAGGCCTACTTCGGCCAGCGCCGGATCCCGGACTACTGGTGGTTCGTCAGGGGCGTCGAGGGCGTCACCGGCGTCATCATGGTCGTGCTCATGGCCGTCGCCTACACGCTGGCGCACC
CGTGGTTCCGCCGGGGAAAGCTCAGCGAGGGCAACCCGCTGCGCCGCCTCAGCGGCTTCAACATGTTCTGGTACTCGCACCACCTCTTCGTCATCGTCTACGTCGCCTTCGTCGTCCATG
GCGTCTGCCTCTACATCAACCGGACCTGGTACAAGCAGACG
GTGAGGATTTGACTTCCATTCAGAATTTGAGATCGCCATATGTACGTTCATGTGTCTTGGTTCTGACAAAAACCTGTCG
CTTGAAATGATGCAAATCCAGACATGGATGTACCTCGCCATCCCCATCCTGCTCTACGCCGGCGAGCGGCTTTTCCGGGCGCTGAGGTCCCATGGCCTCACCACCGTGAGGATCGAGAAG
GTCGCCCTGTACCCCGGAAATGTCATCGCCATTCACATGAGCAAGCCGCACGGGTTCAGCTACAAGAGCGGGCAGTACATCTACGTCAACTGCGGCGAGGTCTCGCCGTTCGAGTG
GTAA
GCCGCCGCCTCCGTCGTCATCAATTACATTGCCGGCGACCGGCGTCGGCGACCGAGATCGCGCGCCATGTATAGTTGCTTAATTCGTTCGTGGCTGCACTGCACACACTGCAGGCACCCG
TTCACCATCACCTCGGCGCCCGGCGACGACTACCTGAGCATGCACATCCGGTGCCGCGGCGACTGGACGACCAGCTTCAGGGCGCTGTTCGCGCAGGTGTGCCGCCCGCCCGCCGCCGGG
CAGAGCGGCCTCCTGCGGGCCGACTTCGCGTCCTCCACGGCGGCGGCGTCCGCCGGCGGCGGGAAGCTCCCGAAGCTGCTGATCGACGGGCCCTACGGCGCGCCCGCGCAGGACTACCGC
AAGTACGACGTGCTCCTCCTGATCGGTCTCGGCATCGGCGCCACCCCGCTCATCAGCATCGTCAAGGACGTGCTCAACAACATCTCCGACGACGACGAAGAGCAGCCGTCGTCATCATCG
TCGGCGGCGGCGGAGTTCATGACGCGGCGGGTGTACTTCTACTGGTGCACGCGGGAGGAAGGGTCCTTCGAGTGGTTCCGCGGCGTGATGAACGAGGTGGCGGAGCGGGACGCCCGCGGC
GACGTGGTGGAGCTCCACAACCACTGCACCAGCGTGTACGAGGAAGGCGACGCGCGGTCGGCGCTGCTGGTGATGCTGCAGGCGCTGCACCACGCCAAGAGCGGCGTCGACGTGGTGTCA
GGGACGCGGGTGCGCACGCACTTCGCGCGGCCCAACTGGCGGGACGTCTTCAAGCGGGTGGCCTGCAACCACCAGGGCCAGCGCGTCGGCGTCTTCTACTGCGGCGACCAGAAGGTCACG
CCGGAGCTCCGCCGGCTGTCGCAGGACTTCTCCCACAAGACCACCACCAAGTTCGTCTTCCACAAGGAGAACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCATCGTCGGGCCAGCAGCACGAGACCGGACCGCCGCCGCCGACGGCGTTCAAGAGCGCGTCCACGGACGGCAAGAGCGGTAGCCGCCGGAGCACGCGGTTCAAGGACGAGGAC
GAGTACGTCGAGGTCACGCTCGACGTCCGCGACGACGGCGGCGGCGACGTCGCCGTCCGGGCCATCAAGGACGTCGTCCTTGCCGGCGGCCCCGGCGTCTTGGGCGACGCGCAGGACGCC
ACGGCGCTCCTGGACCCCCCACCCACCGGCTCTGCTGCTGCTGCTGCCTCGGGGGGCCTGTCGTCCAAGCTCAGGGCCGCGCGGGCGCACCTCGGTCGCATCGCCTCGGTCAAGCGCGCC
GCCGTGCCGCTCTCGGCGCTGCTCCGCCGCGACCGCGACCGGGACCGGGACCGCTCCAGCAGGCTCGACAGGAGCGTCGTCACGGGCGCCGCCAGCGCGCTCAGGGGCCTCCAGTTCCTC
AACCAGGCCGCCGTCACCGAGGGGTGGACCGAGGTGGAGAAGCGCTTCCAGCGCCTCGCCGTCGACGGTTTCCTCCTCCGCTCACGCTTCGGACAGTGCATTG
GCATGGTTGGATCCGAG
GAGTTTGCCGCGCAGATCTTCGACGCACTTGCACGGCGAAGGGGCATCACAGCCATGGTGCTCACCAAGGATCAGGTCCGGGAGTTCTGGGAGCAGCTCTCTGATCCTGGATTCGATGCC
AAGCTTCAGACCTTCTTTGACAT
GGTTGACAAGAATGCTGATGGTCAGATCACTGAAGAGGAGCTCAAAGAGGTCCTCACTTTGACCGCCTCTGCCAACAAGCTGTCCAAGATCCTGGAG
CGCGTCGACGAGTACACCGCGCTGATCATGGAGGAGCTCGATCCCGACAACCTCGGCTACATCGAG
CTCGCGAACCTGGAGTCGCTGCTGCTGCAGCCGGCGCCGGCGTCGACGTCGACG
AGGCTGGTGACGCACAGCTCCAACAACATCAGCCAGCTGATCAGCCAGAGGCTGGCGCCGGCGCGCGACGACAGCGCGCTCCGCCGCGCCGCCATGGCATTCCTCTACTTCATGGAGGAC
AACTGGAAGCGCGTGTGGGTGATGTCGCTGTGGCTGGCCATCAACGCGGCGCTCTTCGCCTGGAAGTTCGCCGCGTACCGCCGCCACCCGACGTTCGACGTGATGGGCTACTGCGTCTGC
GTCGCCAAGGGCGGCGCCGAGACCACCAAGTTCAACATGGCGCTCATCCTGCTCCCCGTCTGCCGGAACACCATCACCTGGCTCCGGTCCCGGACAAGACTCGGCGCCGCCGTCCCGTTC
AACGACAACATCAACTTCCACAAGGTGGTGGCCGGGGGCGTCGCCGTCGGCGTCGCGCTGCACGCTGTGACGCACCTCACGTGCGACTTCCCGAGGCTGCTGCACGCCAGCGCCGCCGCG
TACGAGCCCATGAAGGCCTACTTCGGCCAGCGCCGGATCCCGGACTACTGGTGGTTCGTCAGGGGCGTCGAGGGCGTCACCGGCGTCATCATGGTCGTGCTCATGGCCGTCGCCTACACG
CTGGCGCACCCGTGGTTCCGCCGGGGAAAGCTCAGCGAGGGCAACCCGCTGCGCCGCCTCAGCGGCTTCAACATGTTCTGGTACTCGCACCACCTCTTCGTCATCGTCTACGTCGCCTTC
GTCGTCCATGGCGTCTGCCTCTACATCAACCGGACCTGGTACAAGCAGACG
ACATGGATGTACCTCGCCATCCCCATCCTGCTCTACGCCGGCGAGCGGCTTTTCCGGGCGCTGAGGTCC
CATGGCCTCACCACCGTGAGGATCGAGAAGGTCGCCCTGTACCCCGGAAATGTCATCGCCATTCACATGAGCAAGCCGCACGGGTTCAGCTACAAGAGCGGGCAGTACATCTACGTCAAC
TGCGGCGAGGTCTCGCCGTTCGAGTG
GCACCCGTTCACCATCACCTCGGCGCCCGGCGACGACTACCTGAGCATGCACATCCGGTGCCGCGGCGACTGGACGACCAGCTTCAGGGCGCTG
TTCGCGCAGGTGTGCCGCCCGCCCGCCGCCGGGCAGAGCGGCCTCCTGCGGGCCGACTTCGCGTCCTCCACGGCGGCGGCGTCCGCCGGCGGCGGGAAGCTCCCGAAGCTGCTGATCGAC
GGGCCCTACGGCGCGCCCGCGCAGGACTACCGCAAGTACGACGTGCTCCTCCTGATCGGTCTCGGCATCGGCGCCACCCCGCTCATCAGCATCGTCAAGGACGTGCTCAACAACATCTCC
GACGACGACGAAGAGCAGCCGTCGTCATCATCGTCGGCGGCGGCGGAGTTCATGACGCGGCGGGTGTACTTCTACTGGTGCACGCGGGAGGAAGGGTCCTTCGAGTGGTTCCGCGGCGTG
ATGAACGAGGTGGCGGAGCGGGACGCCCGCGGCGACGTGGTGGAGCTCCACAACCACTGCACCAGCGTGTACGAGGAAGGCGACGCGCGGTCGGCGCTGCTGGTGATGCTGCAGGCGCTG
CACCACGCCAAGAGCGGCGTCGACGTGGTGTCAGGGACGCGGGTGCGCACGCACTTCGCGCGGCCCAACTGGCGGGACGTCTTCAAGCGGGTGGCCTGCAACCACCAGGGCCAGCGCGTC
GGCGTCTTCTACTGCGGCGACCAGAAGGTCACGCCGGAGCTCCGCCGGCTGTCGCAGGACTTCTCCCACAAGACCACCACCAAGTTCGTCTTCCACAAGGAGAACTTCTGA

Retrieve as FASTA