Entry information : MguPrx51 (mgv1a010371m)
Entry ID 9220
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx51 (mgv1a010371m)
Name (synonym) MguPrx51 (mgv1a010371m)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx51
start..stop
S start..stop
PpePrx62 494 4e-178 3..314 13..324
EgrPrx56 491 5e-177 4..314 13..323
EgrPrx102 490 9e-177 4..314 13..323
EglPrx56 488 6e-176 4..314 13..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 216820..217011 192 N° 2 216533..216721 189 N° 3 215102..215662 561  
complement(join(215102..215662,216533..216721,216820..217011))


exon

Literature and cross-references MguPrx51 (mgv1a010371m)
DNA ref. Phytozome 12:   scaffold_8 (217011..215102)
Protein sequence: MguPrx51 (mgv1a010371m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (297)
PWM (Da):   %s   34064.16 (32337.2)  
PI (pH):   %s   8.2 (8.20) Peptide Signal:   %s   cut: 18 range:18-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMSILLLLVGIISQSGAILDANYYEKTCPQAENIINQAVRKAAANDPKVPARILRMFFHDCFIRGCDASVLLDSTANNKAEKDGPPNLSLAAFYVIDAAKKNLEESCPRTVSCADVLAIAARDVVVLSGGPKWNVAKGRKDGRISTANDTVNLPAPSFNTTQLIQSFSQRGLSAKDLVALSGGHTLGFSHCSSFESRLRNFSSAHDSDPTLDPQFAAALKSRCPKPNSDRNAGQFLDSTSSVFDNDYYRRIVAGKGVFGSDQSLMADYRTRWIVEAFARDRGLFFWEFAASMVRLGNVGVVEDGEVRTNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAGCATTTTGCTTCTTTTAGTAGGGATAATTTCCCAATCGGGAGCAATTCTCGACGCGAATTATTACGAAAAAACATGCCCACAAGCTGAAAACATCATCAACCAAGCTGTCCGA
AAGGCCGCAGCCAACGATCCTAAAGTACCTGCTCGTATTTTAAGAATGTTTTTTCATGATTGCTTCATTAGG
GTACGTTTCTTATATCGAATATTCATCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGTTCGTTGAACGATTATTTATTAGGGTTGCGACGCGTCGGTTTTGTTGGACTCGACTGCGAACAACAAAGCGGAGAAAGATGGCCCGCCGAATT
TGTCGCTCGCAGCATTTTATGTGATAGATGCTGCGAAAAAGAATCTAGAAGAATCTTGCCCAAGAACTGTGTCTTGTGCTGATGTATTAGCAATTGCTGCAAGAGATGTTGTTGTTCTG
G
TAATGTTTCACTTAATTCATTTCTTCAACGTACACTTGATGGTTAAACTTAACGAAACGTTGCAATTAACGGCATTTTTATCGAAATATTTCGTCGTTTTATAATATTTAATCTATATAA
CCCGTTTTATTTGTCGTTTAAGATTTAGTTATACAGATAAAGAAACTTGTCAAATAAATTTTGAATTTGATAAGGGAAAACCCCAAAATAACATCTCTAACAATATTAATTAACTGTTAA
TTGATATGATATGATCAACAGTAAAGTTGGCGCCACAGNNNNNNNNNNNNNNNNNNNNNNNNGCTTAAAAAATCGAAGACAATGAATTAAATATCATGAAAAACATTTTTCCCGCCTAAA
AGTAACAAAATAAATGGTAGAATGATATTCTATAAAATTAGATTGGAATTGAGAATTTAAAAAATATCGGATTTTTTTACCAAATGAAATTTAGACATAATAGTGTCCTTTGATCAATTA
TGCATGTTACCAATTTTGCCCCTCTATCATGATCTATAAGNNNNNNNNNNNNNNNNNNNNNCTTATTGATTATTTCACTCGTCACCTCGATGTTTACTTTAACCGCAGTCTATAAGATAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNACGCTTTCAACTGCTAAATTGCATAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TTTTTGGTAAAATTGACTACTTATTACAGTCAGGAGGGCCAAAGTGGAATGTGGCGAAAGGAAGAAAAGACGGCAGAATCTCAACCGCAAACGACACCGTCAACCTGCCGGCGCCGTCGT
TCAACACAACCCAACTCATCCAGAGCTTTTCCCAGCGGGGACTCTCCGCCAAGGACCTCGTCGCTCTCTCCGGCGGCCACACCCTCGGCTTCTCCCACTGCTCCTCCTTCGAATCCCGCC
TCCGCAACTTCAGCTCCGCCCACGACTCCGACCCGACACTCGACCCGCAATTCGCCGCCGCATTGAAGAGCCGGTGCCCCAAGCCCAACTCCGACCGCAACGCCGGCCAGTTCCTCGACT
CGACCTCGTCGGTCTTCGACAACGACTACTACAGAAGGATCGTCGCCGGAAAAGGAGTTTTCGGGTCGGATCAATCGCTGATGGCCGATTACCGGACCCGGTGGATCGTCGAGGCGTTCG
CGAGGGATCGGGGTTTGTTTTTCTGGGAATTCGCTGCTTCCATGGTGAGGCTTGGGAATGTCGGAGTTGTTGAGGATGGAGAAGTCAGAACCAACTGCCGGGTCGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAGCATTTTGCTTCTTTTAGTAGGGATAATTTCCCAATCGGGAGCAATTCTCGACGCGAATTATTACGAAAAAACATGCCCACAAGCTGAAAACATCATCAACCAAGCTGTCCGA
AAGGCCGCAGCCAACGATCCTAAAGTACCTGCTCGTATTTTAAGAATGTTTTTTCATGATTGCTTCATTAGG
GGTTGCGACGCGTCGGTTTTGTTGGACTCGACTGCGAACAACAAAGCG
GAGAAAGATGGCCCGCCGAATTTGTCGCTCGCAGCATTTTATGTGATAGATGCTGCGAAAAAGAATCTAGAAGAATCTTGCCCAAGAACTGTGTCTTGTGCTGATGTATTAGCAATTGCT
GCAAGAGATGTTGTTGTTCTG
TCAGGAGGGCCAAAGTGGAATGTGGCGAAAGGAAGAAAAGACGGCAGAATCTCAACCGCAAACGACACCGTCAACCTGCCGGCGCCGTCGTTCAACACA
ACCCAACTCATCCAGAGCTTTTCCCAGCGGGGACTCTCCGCCAAGGACCTCGTCGCTCTCTCCGGCGGCCACACCCTCGGCTTCTCCCACTGCTCCTCCTTCGAATCCCGCCTCCGCAAC
TTCAGCTCCGCCCACGACTCCGACCCGACACTCGACCCGCAATTCGCCGCCGCATTGAAGAGCCGGTGCCCCAAGCCCAACTCCGACCGCAACGCCGGCCAGTTCCTCGACTCGACCTCG
TCGGTCTTCGACAACGACTACTACAGAAGGATCGTCGCCGGAAAAGGAGTTTTCGGGTCGGATCAATCGCTGATGGCCGATTACCGGACCCGGTGGATCGTCGAGGCGTTCGCGAGGGAT
CGGGGTTTGTTTTTCTGGGAATTCGCTGCTTCCATGGTGAGGCTTGGGAATGTCGGAGTTGTTGAGGATGGAGAAGTCAGAACCAACTGCCGGGTCGTTAAC

Retrieve as FASTA