Entry information : MguPrx53 (mgv1a010413m)
Entry ID 9222
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx53 (mgv1a010413m)
Name (synonym) MguPrx53 (mgv1a010413m)
Class Class III peroxidase     [Orthogroup: Prx004]*
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx53
start..stop
S start..stop
EgrPrx83 420 4e-149 6..313 11..327
VvPrx61 418 4e-148 23..313 24..326
EcamPrx87 416 2e-147 6..313 11..327
LePrx102 415 6e-147 10..313 9..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1982883..1983101 219 N° 2 1983212..1983361 150 N° 3 1983609..1983774 166 N° 4 1983916..1984319 404
join(1982883..1983101,1983212..1983361,1983609..1983774,1983916..1984319)


exon

Literature and cross-references MguPrx53 (mgv1a010413m)
DNA ref. Phytozome 12:   scaffold_24 (1982883..1984319)
Protein sequence: MguPrx53 (mgv1a010413m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313 (288)
PWM (Da):   %s   34291.73 (31648.2)  
PI (pH):   %s   8.56 (8.56) Peptide Signal:   %s   cut: 26 range:26-313
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSLTVLLQLTLLVSFAILIFQANGQGLKVGFYPYKWPNLEPVIKDVIYKVISEDRTLAPPLQRMHFHDCFIRGCEGSFLLESPTKQAEKDAFPNLTLRGFQILDKVKLAVEKACSGDVSSADIMGPFWEVETGRKDGKVSILNEALTGLIPPSANISTLKKGFADRGLNMKDLVVLSGSHTIGISHCSSFSNRLYNFTGKNDADPTLDSEYAAKLKQKCKPGDQNSIVEMDPGSFKTFDVSYFTLVAKRRGLFESDAALLNDGETKAYLKFQALNKGPTFFKDFGESMVKMGRIGVITGEGGEIRKVCTKV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTCTCTAACTGTATTATTACAGTTGACCTTGTTAGTTTCTTTTGCAATATTAATCTTTCAAGCAAATGGACAAGGCCTCAAAGTAGGATTTTATCCCTATAAATGGCCGAATCTC
GAACCGGTAATCAAAGACGTTATCTACAAAGTCATTTCCGAAGATCGGACTCTTGCACCTCCTTTGCAAAGAATGCATTTTCATGATTGCTTTATTAGG
GCAAGTTGTTTTCTATATACA
ATATAATTAAGAATTGTTAATTACTAAGATAATTTTATTTACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTTCGTGTATTAGGGGTGTGAGGGGTCGTTTTTATTGGAGTCTC
CCACTAAGCAAGCAGAGAAAGATGCCTTCCCCAATTTAACCCTAAGAGGGTTCCAAATACTCGACAAAGTAAAATTAGCCGTCGAGAAAGCTTGTTCGGGGGACGTCTCGAGTGCCGAT
G
TACTACCCATAGTTGAAGAGATGTCACCTTTGCAGTATATACAATTTCATACAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTAATTTTAGTTTCTCCTAAATATTGAGTTTTTTTTGAAAAAATAAATCATTTTGAATGCACCGTATAATTATAT
TATCAGATTATGGGGCCATTTTGGGAAGTCGAAACGGGGCGAAAAGACGGGAAAGTATCGATCTTGAATGAAGCCTTGACCGGGTTAATACCACCCTCTGCAAACATTAGTACTTTGAAA
AAAGGATTTGCAGATAGGGGTTTAAACATGAAGGATCTTGTTGTCTTATCAG
GTACATTTAAATTGGGAAAATTGTAAATTTGGTCCCCGTAGTTTGGCCTGATGCTTAGAAATTTAGTC
GTCATAAACTTTCTATTTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCCACACAATTGGGATTTCTCACTGCTCGTCTTTTAGTAACCGG
CTCTACAATTTCACGGGAAAGAACGACGCGGACCCCACTTTGGATTCCGAGTACGCAGCGAAGTTGAAGCAGAAGTGCAAACCCGGGGATCAAAACTCGATAGTGGAGATGGATCCGGGG
AGTTTCAAAACTTTTGATGTATCTTATTTTACGCTCGTTGCAAAAAGAAGGGGGCTTTTCGAATCGGATGCAGCACTCTTGAACGACGGCGAGACTAAGGCGTATCTCAAATTTCAGGCA
CTGAATAAGGGACCCACTTTCTTTAAGGATTTTGGCGAGTCGATGGTGAAAATGGGGAGAATCGGTGTGATTACGGGCGAGGGAGGTGAGATCAGAAAAGTTTGCACTAAAGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTCTCTAACTGTATTATTACAGTTGACCTTGTTAGTTTCTTTTGCAATATTAATCTTTCAAGCAAATGGACAAGGCCTCAAAGTAGGATTTTATCCCTATAAATGGCCGAATCTC
GAACCGGTAATCAAAGACGTTATCTACAAAGTCATTTCCGAAGATCGGACTCTTGCACCTCCTTTGCAAAGAATGCATTTTCATGATTGCTTTATTAGG
GGGTGTGAGGGGTCGTTTTTA
TTGGAGTCTCCCACTAAGCAAGCAGAGAAAGATGCCTTCCCCAATTTAACCCTAAGAGGGTTCCAAATACTCGACAAAGTAAAATTAGCCGTCGAGAAAGCTTGTTCGGGGGACGTCTCG
AGTGCCGAT
ATTATGGGGCCATTTTGGGAAGTCGAAACGGGGCGAAAAGACGGGAAAGTATCGATCTTGAATGAAGCCTTGACCGGGTTAATACCACCCTCTGCAAACATTAGTACTTTG
AAAAAAGGATTTGCAGATAGGGGTTTAAACATGAAGGATCTTGTTGTCTTATCAG
GTAGCCACACAATTGGGATTTCTCACTGCTCGTCTTTTAGTAACCGGCTCTACAATTTCACGGGA
AAGAACGACGCGGACCCCACTTTGGATTCCGAGTACGCAGCGAAGTTGAAGCAGAAGTGCAAACCCGGGGATCAAAACTCGATAGTGGAGATGGATCCGGGGAGTTTCAAAACTTTTGAT
GTATCTTATTTTACGCTCGTTGCAAAAAGAAGGGGGCTTTTCGAATCGGATGCAGCACTCTTGAACGACGGCGAGACTAAGGCGTATCTCAAATTTCAGGCACTGAATAAGGGACCCACT
TTCTTTAAGGATTTTGGCGAGTCGATGGTGAAAATGGGGAGAATCGGTGTGATTACGGGCGAGGGAGGTGAGATCAGAAAAGTTTGCACTAAAGTTAAC

Retrieve as FASTA