Entry information : MguPrx54 (mgv1a010460m)
Entry ID 9223
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-03 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-03 (Qiang Li)
Peroxidase information: MguPrx54 (mgv1a010460m)
Name (synonym) MguPrx54 (mgv1a010460m)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx54
start..stop
S start..stop
NtPrx06-1B 394 1e-138 4..307 9..331
NtPrx06-1A 386 1e-135 17..307 22..329
EgrPrx126 372 4e-130 29..309 27..328
EguPrx126 370 3e-129 29..309 27..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 242026..242253 228 N° 2 241643..241724 82 N° 3 241534..241580 47 N° 4 241228..241393 166
N° 5 240577..240968 392  
complement(join(240577..240968,241228..241393,241534..241580,241643..241724,2420 26..242253))


exon

Literature and cross-references MguPrx54 (mgv1a010460m)
DNA ref. Phytozome 12:   scaffold_113 (242253..240577)
Protein sequence: MguPrx54 (mgv1a010460m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (292)
PWM (Da):   %s   34004.72 (31823.5)  
PI (pH):   %s   10.11 (10.08) Peptide Signal:   %s   cut: 20 range:20-311
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTLLGFVLVFVSLTVVYGAGKKAPVKPGLRLDFYKSTRCPKAEQLVKQVTEARVRKDSTLGAKLIRLHYHDCFVKGCDASILLDTVGTNQSEKDARPNRSLGVLDILALAAREAVSFPFKRPMWDVLTGRKDGRVSLLSDVTGNLPSPFSNFSTLQNLFSNKKLDINDLVALSGAHTIGVAHCGAFARRLNFTGRNDTDPSLDPSYGEFLKRQCPTPVNSTTTVGMDPNSTLTFDSHYFSAVNKKQGLFQSDAALITDPTSAGIVTRFQSPSAFFRQFKLSMVKMGAIEVLVGDAGEIRKNCRVINQSIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAACTTTACTAGGGTTTGTGCTCGTGTTTGTGTCTCTTACCGTGGTTTATGGAGCCGGTAAGAAGGCTCCAGTTAAACCCGGTTTGAGATTGGACTTTTACAAAAGCACCCGTTGT
CCAAAAGCCGAGCAACTTGTGAAACAAGTTACTGAAGCTCGAGTCCGTAAAGACTCTACTTTGGGTGCTAAGCTTATTCGTCTGCATTATCACGATTGTTTCGTCAAG
GTATATATATAG
TTCTTCATCGTTTTGTGCTAAAATTAGAATTTTACGTAGATCAACATATTTTCATGCATTTCTATTAACAAGTTATGTTAGGTTCTCGATCATGAACGGCCCATTGATTTGGAAAAAAAA
TATTTTATAGAAGAATTTGTTAATTTTCAGTTAGTGCAGTAATATTATTGTCAACCGTCATACATAATATATTTCCAATTTATATTTGTCTCCGAACAAAATTCTTGCTTAGATTGACAA
TATATAATAATGTACTTATAAAGCATTTTTTTTTTAATAAATTGTATAGGGATGCGACGCATCGATACTTTTGGACACGGTAGGAACAAATCAATCGGAAAAAGACGCAAGGCCAAATCG
GTCATTGGGCG
GTTCGACGTTATCGATGAAATCAAGACACGGGTCGAAAATGATTGCCCCGGAATTGTTTCAGTGCTGGATATTCTGGCACTCGCTGCTCGTGAGGCCGTTTCTTTTCCG
GTAAGTTAAGGTTCAGGTCATCTCTCTAATTAATTATTCTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATTAATTTATGATTATATAAACA
TTGTTTGTAATTGGTAACAGTTTAAGAGGCCGATGTGGGATGTGCTGACCGGAAGAAAAGACGGCCGGGTTTCTCTTCTATCGGACGTCACCGGCAACTTACCTTCTCCGTTTTCAAATT
TTTCGACGCTTCAGAATCTGTTCTCAAACAAAAAGCTAGACATCAATGATCTCGTTGCATTATCAG
GNNNNNNNNNNNNNNNNNNNNNNNNATATTTTCACTAAAATTATATATATATAT
ACCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAATATAATTACAGGCGCACACACGATCGGAGTGGCGCACTGCGGGGCA
TTCGCGCGGCGGCTGAACTTCACCGGAAGAAACGACACCGACCCGTCGCTGGACCCGAGCTACGGGGAGTTCTTGAAGAGGCAGTGCCCGACGCCGGTCAACTCCACCACGACGGTGGGC
ATGGACCCTAACAGTACCCTCACCTTCGACTCACACTACTTCTCCGCCGTGAACAAGAAGCAGGGCCTGTTCCAGTCCGACGCCGCCCTTATCACCGACCCGACTTCCGCTGGAATCGTG
ACACGGTTTCAGTCTCCGTCGGCGTTTTTCAGGCAGTTTAAGTTGTCGATGGTGAAGATGGGAGCTATTGAGGTGCTGGTCGGAGATGCTGGGGAGATCAGAAAGAATTGCCGCGTG

Retrieve as FASTA