Entry information : MguPrx65 (mgv1a014238m)
Entry ID 9226
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang LI)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx65 (mgv1a014238m)
Name (synonym) MguPrx65 (mgv1a014238m)
Class Class III peroxidase     [Orthogroup: Prx013]*
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx65
start..stop
S start..stop
MguPrx54 308 6e-107 1..195 1..175
LePrx64 266 4e-90 1..195 1..194
NtPrx06-1B 265 1e-89 9..195 14..198
StPrx53 264 2e-89 1..195 1..195
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 249493..249717 225 N° 2 248949..249140 192 N° 3 248665..248835 171  
complement(join(248665..248835,248949..249140,249493..249717))


exon

Literature and cross-references MguPrx65 (mgv1a014238m)
DNA ref. Phytozome 12:   scaffold_113 (249717..248665)
Protein sequence: MguPrx65 (mgv1a014238m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   196 (177)
PWM (Da):   %s   21269.21 (19114.0) Transmb domain:   %s   o4-21i
PI (pH):   %s   8.75 (8.49) Peptide Signal:   %s   cut: 20 range:20-196
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTLLVFVLVFLSLTMVYGAGKAPVKPGLRLDFYKSTRCPQAEQLVKQVTEARVRRDATLGAKLIRLHYHDCFVKGCDASILLDTVGTTQSEKDARPNLSLGGFDVIDEIKTRVENVCPGIVSCADILALAARDAVSLPFNRPMWNVLTGRKDGRVSLLSDVTGNLPSPFSNFATLQNLFSNKNLDINDLVALSGN

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (3' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAACTTTACTAGTGTTTGTGCTCGTTTTTCTGTCTCTTACCATGGTTTATGGAGCTGGTAAGGCTCCGGTTAAACCCGGTTTGAGATTGGACTTTTACAAAAGTACTCGTTGTCCA
CAAGCCGAGCAGCTTGTGAAACAAGTTACTGAAGCTAGAGTCCGTAGAGACGCTACCTTGGGTGCTAAGCTTATTCGCTTGCATTACCATGATTGTTTCGTTAAG
GTATATATACATATA
TATAAATTTCACATGCAATAACCATATTTTCGAGCATAATGTCTTAATTGTTTCTTAGCATTTCTATTTTATTTTTAAAATATACGTTAAATTTGATTCTATAAAACAATGTCAGAGCCA
GCATAAGGCGCCATATCATAATCCGATGGCGGCCTTCCATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCAACCCTCGTAGAATTTTTTTAATGAA
TATAATTTGTACCCAAATATTACATAATTCTTGCTCAACTAGTTCAAGATTGACAATATATATATGTAATGTACTTATAATTAAATAAATTGGATAGGGATGCGACGCATCGATACTTTT
GGACACGGTAGGTACGACTCAATCGGAAAAGGATGCAAGGCCAAATCTGTCATTGGGCGGGTTCGACGTTATCGATGAAATCAAGACGCGCGTCGAAAATGTTTGCCCCGGAATTGTTTC
TTGTGCTGATATTCTTGCACTCGCTGCCCGTGATGCTGTTTCTCTTCCT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGTTTTAACATTTTGTAATTGGCATGTACAGTTCAATAGGCCGATGTGGAATGTGCTGACCGGAAGAAAAGACGGCCGGGTTTCTCTGTTGTCGGATGTCACCGGCAAC
TTACCTTCTCCGTTTTCGAATTTTGCGACGCTTCAGAATCTGTTTTCGAATAAAAATTTAGACATCAATGATCTCGTTGCATTATCAGGTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAACTTTACTAGTGTTTGTGCTCGTTTTTCTGTCTCTTACCATGGTTTATGGAGCTGGTAAGGCTCCGGTTAAACCCGGTTTGAGATTGGACTTTTACAAAAGTACTCGTTGTCCA
CAAGCCGAGCAGCTTGTGAAACAAGTTACTGAAGCTAGAGTCCGTAGAGACGCTACCTTGGGTGCTAAGCTTATTCGCTTGCATTACCATGATTGTTTCGTTAAG
GGATGCGACGCATCG
ATACTTTTGGACACGGTAGGTACGACTCAATCGGAAAAGGATGCAAGGCCAAATCTGTCATTGGGCGGGTTCGACGTTATCGATGAAATCAAGACGCGCGTCGAAAATGTTTGCCCCGGA
ATTGTTTCTTGTGCTGATATTCTTGCACTCGCTGCCCGTGATGCTGTTTCTCTTCCT
TTCAATAGGCCGATGTGGAATGTGCTGACCGGAAGAAAAGACGGCCGGGTTTCTCTGTTGTCG
GATGTCACCGGCAACTTACCTTCTCCGTTTTCGAATTTTGCGACGCTTCAGAATCTGTTTTCGAATAAAAATTTAGACATCAATGATCTCGTTGCATTATCAGGTAAT

Retrieve as FASTA