Entry information : MguPrx67 (mgv1a017718m)
Entry ID 9228
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx67 (mgv1a017718m)
Name (synonym) MguPrx67 (mgv1a017718m)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx67
start..stop
S start..stop
CmicPrx01 458 7e-164 4..320 7..323
LePrx91 454 3e-162 4..320 9..323
AcoPrx32 448 6e-160 2..320 3..324
AcoPrx116 448 6e-160 2..320 3..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 254721..254924 204 N° 2 254413..254604 192 N° 3 253917..254082 166 N° 4 252816..253213 398
complement(join(252816..253213,253917..254082,254413..254604,254721..254924))


exon

Literature and cross-references MguPrx67 (mgv1a017718m)
DNA ref. Phytozome 12:   scaffold_113 (254924..252816)
Protein sequence: MguPrx67 (mgv1a017718m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (300)
PWM (Da):   %s   34737.65 (32517.6)  
PI (pH):   %s   8.35 (8.56) Peptide Signal:   %s   cut: 21 range:21-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKIFSTILLCFLALGFCECGGLTNNFYSTSCPNAEKIVKKIISKHVANDATLPAKLLRMHFHDCFVRGCDGSVLIDSTAKHKAEKEAVPNLSLGGFEVIEEIKTQLEKTCPGIVSCADVLALAARDSVSFKFNKPMWEVETGRRDGIVSRESDALNELPSPASDFKTLKQSFADKGLSVKDLVVLSGAHTIGVGKCIVFSNRLYNFTGKGDTDTSLNTTYAATLRSKCRSLSDQTTTVEMDPTSSLDFDNHYFTALKLRQGLFQSDAALLTNDVARGVVDQMLTSGKFYTQFGKSMKKMGAIGVLTGDEGKIRKKCNI

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAAAATTTTCTCGACAATCTTGTTATGTTTCCTGGCATTAGGGTTCTGCGAATGCGGAGGATTAACTAATAACTTTTATAGTACGAGTTGCCCCAATGCCGAGAAAATTGTTAAG
AAAATAATTAGTAAACATGTAGCTAATGATGCAACATTGCCTGCTAAGCTTCTCAGAATGCATTTTCATGACTGCTTTGTTAGG
GTATAATAATTAACCAAAGTTCATTAATTTCAGTTT
TAACATGATAATTCAATTTTATAATAAGATCTCGATTTCTTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTTGTGATGGATCGGTGCTGATAGATTCTACTGCAAAAC
ATAAAGCAGAAAAGGAAGCGGTCCCGAATCTGTCTTTGGGAGGATTCGAAGTTATAGAGGAAATCAAGACTCAGCTCGAGAAAACTTGCCCTGGAATTGTTTCGTGTGCTGATGTTCTCG
CTTTAGCTGCGAGGGACTCGGTTTCGTTCAAA
GTAAGTTTTTAGATCAACAAATTGCCAATTGTAATTTTAGTGGAAATGNNNNNNNNNNNNNNNNNNNNNGACCCATCACTTATTCCCT
CTCGAATTTAATTTGTTAAGATTAATTCTTTTGTATTTTTATCAGCATAAATTCCCCTATGGTGTTGTTATTTCTTGATAATTAGGGTAAAAGTATTAAAAGAAGCATAATTTTGTGTAA
GAAAACTCACTGAACATGCCATGCATGCATGCACGTACATGATCAATGTATATAACTTTTGTTCTGTGTATCTATAAATCTGCAATGTAATATAACAGCATTTATGGAAACTAATAATAC
AGTTCAATAAACCGATGTGGGAGGTGGAAACAGGCAGAAGAGACGGCATCGTTTCACGCGAATCCGATGCCTTAAACGAACTCCCTTCACCCGCTTCCGATTTCAAAACCCTAAAACAAT
CTTTTGCCGACAAAGGCCTCTCTGTCAAGGATCTTGTTGTTCTTTCAG
GTTCTATATATTACTTATCTTCTAAAGTTAGTACTGCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAACTGTAACATCCGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTAAACATGATTTTCACCTCTAATATAATTATCAAAAAATAATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTATGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCACACACACACACACAGGAGCTCACACTATCGGTGTCGGGAAGTGCATCGTATTCAGCAACAGGCTGTACAATTTCACCGGAAAAGGAGACACGGATACTTCCTTA
AACACTACCTACGCCGCCACACTGCGATCAAAATGCCGAAGCTTGTCCGACCAAACAACGACGGTTGAAATGGACCCCACAAGCTCTTTGGATTTCGACAATCATTATTTCACGGCGTTA
AAACTCCGTCAGGGACTTTTTCAGTCGGACGCCGCCCTTTTGACCAATGACGTGGCACGCGGCGTGGTTGACCAGATGTTGACTTCTGGAAAGTTTTATACTCAGTTTGGAAAATCCATG
AAGAAGATGGGTGCAATTGGTGTGCTTACTGGAGATGAAGGGAAAATCAGAAAGAAATGCAATATTGTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGAAAATTTTCTCGACAATCTTGTTATGTTTCCTGGCATTAGGGTTCTGCGAATGCGGAGGATTAACTAATAACTTTTATAGTACGAGTTGCCCCAATGCCGAGAAAATTGTTAAG
AAAATAATTAGTAAACATGTAGCTAATGATGCAACATTGCCTGCTAAGCTTCTCAGAATGCATTTTCATGACTGCTTTGTTAGG
GGTTGTGATGGATCGGTGCTGATAGATTCTACTGCA
AAACATAAAGCAGAAAAGGAAGCGGTCCCGAATCTGTCTTTGGGAGGATTCGAAGTTATAGAGGAAATCAAGACTCAGCTCGAGAAAACTTGCCCTGGAATTGTTTCGTGTGCTGATGTT
CTCGCTTTAGCTGCGAGGGACTCGGTTTCGTTCAAA
TTCAATAAACCGATGTGGGAGGTGGAAACAGGCAGAAGAGACGGCATCGTTTCACGCGAATCCGATGCCTTAAACGAACTCCCT
TCACCCGCTTCCGATTTCAAAACCCTAAAACAATCTTTTGCCGACAAAGGCCTCTCTGTCAAGGATCTTGTTGTTCTTTCAG
GAGCTCACACTATCGGTGTCGGGAAGTGCATCGTATTC
AGCAACAGGCTGTACAATTTCACCGGAAAAGGAGACACGGATACTTCCTTAAACACTACCTACGCCGCCACACTGCGATCAAAATGCCGAAGCTTGTCCGACCAAACAACGACGGTTGAA
ATGGACCCCACAAGCTCTTTGGATTTCGACAATCATTATTTCACGGCGTTAAAACTCCGTCAGGGACTTTTTCAGTCGGACGCCGCCCTTTTGACCAATGACGTGGCACGCGGCGTGGTT
GACCAGATGTTGACTTCTGGAAAGTTTTATACTCAGTTTGGAAAATCCATGAAGAAGATGGGTGCAATTGGTGTGCTTACTGGAGATGAAGGGAAAATCAGAAAGAAATGCAATATTGTT

Retrieve as FASTA