Entry information : MguPrx74 (mgv1a018852m)
Entry ID 9234
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx74 (mgv1a018852m)
Name (synonym) MguPrx74 (mgv1a018852m)
Class Class III peroxidase     [Orthogroup: Prx016]*
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx74
start..stop
S start..stop
StPrx45 343 9e-118 6..306 76..381
VvPrx12 339 4e-117 3..304 24..328
LePrx77 337 5e-116 6..306 29..334
NtPrx81-1A 335 1e-115 3..300 17..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 65992..66001 10 N° 2 66505..66650 146 N° 3 66734..66919 186 N° 4 67967..68129 163
N° 5 68249..68659 411 N° 6 68758..68789 32  
join(65992..66001,66505..66650,66734..66919,67967..68129,68249..68659,68758..687 89)


exon

Literature and cross-references MguPrx74 (mgv1a018852m)
DNA ref. Phytozome 12:   scaffold_98 (65992..68789)
Protein sequence: MguPrx74 (mgv1a018852m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316
PWM (Da):   %s   33959.96  
PI (pH):   %s   4.65
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSRSELQVGFYSDKCPFAEATVEAAVVDAAVVNPRVAPILLRLHFHDCFVEGCDGSILITTGVQDAEISASAHQGVMGFDVIAKAKAAIEAQCPGVVSCADIVAIAARDAVALAGGPTYEVETGRRDGRLSSANMAWRMPQFHDSVHTLRLKFFEKGLTEADLVLLSGGAHTIGTTACFFVRDRLYAFMGTNTSDPTISPALLPSLERQCPKDGSPMDRLLLDQVTGERFDVQSLINIKNGLSVLPSDSILYDNNITKSVVDFYSVDKSSFAEDFAVAMIKMGRIDVNTGTEGEIRQVCETVNPMFLLYLQSAE*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTCAAGTATGGAAAACCCCATTTTAATTAATTATTAAGTGGTCCATCTGATTTCATTCTATTTCAATATTTTGGATACTTTCTTTCTTTTTCTATTTTTGAGGGCTTGCATGCAT
GCACGTACTTAACACTTATGGTGAATTCATTCTATTTCAATACTTTGGATACTTTCTTTCTTTTTCTATTTTTGAGGGAATGCATGCATGCACGTACTTAATCCTTATGGTGAATTCATT
CTATTTTAAGGTTTTGCGTATGCGTATAACAGCCACCTTTTCCTTTTTTTCACGTGTAAACTTACATTTTTTTTATTAAAAAAAGTGTAAAATAAACGCCAATTCATCAAATTAACAACT
ATATATAGATATGCATGTTATGTCTTATTCTTCCCTCACTGCTTCATCAAAGTTCATAACTTTAATTTCTTTCACCTAATTCCTCAAATTAAATGGATCCAAAAGCAATTTTTTTTGTCA
TAATTATTTTTCACCACCATTTTATTTCAGTAGGAAGCGAACTTCAAGTTGGCTTCTACTCCGACAAGTGTCCATTCGCGGAGGCGACCGTCGAGGCTGCTGTGGTGGACGCTGCGGTAG
TCAACCCTAGGGTTGCCCCGATTCTGCTCCGCCTTCATTTCCACGACTGCTTCGTGGAG
GTGTAATATAATTCCTATCTTACCNNNNNNNNNNNNNNNNNNNNNAATTATTTGTATGTTT
TAACCTTTTATTGTTTCTGTAGGGCTGTGATGGATCCATACTGATTACAACCGGCGTACAGGATGCTGAAATTAGTGCATCCGCACACCAAGGGGTAATGGGGTTCGACGTGATCGCGAA
AGCGAAAGCGGCAATCGAAGCTCAGTGCCCGGGGGTCGTGTCGTGCGCTGATATCGTGGCGATTGCCGCTAGGGATGCCGTCGCCTTG
GTACGTACACGAATCGTTTTAGTTTTGAAGTG
TTTAATTTATTTATGTATAATTTTCTAGCAAAACTTAATCGGAAAATATCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTGGGATACCAATAAGACCAATATATAGTATGTTATACTATATTGATA
CTAAATAAAATATTACTTTTATATTCACTAAGATATTTTTTAAGAAAATATGGATTATTTTACATTATAAGAAATTAGTATTTTTCATTAAATCTGTTACAGTTATAATTTTTAAGAAAA
ACTGGACCTTTTTATGGGCCTATTTCATATATTTAAAATATGTGAAACTAAACTGGCCTATTTCATATATTAAACTGGCCTAACTTGGTTTTTATAATTCAAGTGGATACAATCATACAA
CCGTAAAAAAATAGCCTAAACTTGGTTTTTATATTTACTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTCAAAATTTTATATGATGTAAACTTGCATA
CCAAAAAGACTAATATATAGTATATTACACTATATTGATGCTAAATATAATATTATTACTTTTAAATTCACTAAGATATTTTTTAAGAAAATATGGATTATTTTACACTATAAGAAATTA
GTATTTTTCATTAAATCTGCTACAATTATAATTTTTAAGAAAAACTGGACCTGTTTATGGGCCTATTTAATATATTAAACTGGCCTAACTTGTTACTCAAAGTCAGCCCAGCCCACTTAA
TTATGGGCCTATGTCATATATTAAAAATCGGCCGAACTTCTTACAGCCCAGTTTCAGTCCAAGTCCAACTTAACTCTAATAAAACGTCGCCCTTTGCTTAATCGATGTTTGTGTTTTAAT
TTATTTGTCTTTTGGCTGATTTTTTTGTTTTTCTCTTTTGGCAACACGTGTTAAGGCCGGAGGTCCGACTTATGAGGTCGAGACCGGTAGAAGAGACGGTAGGCTTTCCAGTGCAAATAT
GGCATGGCGCATGCCACAATTTCACGATTCCGTCCACACGCTTCGGTTAAAGTTCTTCGAGAAAGGACTCACCGAAGCCGATCTCGTCTTGCTAAGTG
GTAAGTAGTCNNNNNNNNNNNN
NNNNNNNNNNNNNCATATTAGCTTAGTTTATTCGAGTCACTTTTCAATAAAATCTAAAATAACGGNNNNNNNNNNNNNNNNNNNNNNNNNNCATCAGGGGGAGCACATACGATCGGTACT
ACAGCCTGTTTTTTCGTCAGAGACAGGCTGTACGCCTTCATGGGTACAAATACATCCGATCCAACAATTAGCCCCGCTCTGCTACCTTCACTAGAGCGCCAGTGCCCAAAGGACGGAAGT
CCAATGGATCGACTACTTCTCGATCAAGTGACTGGAGAAAGATTCGACGTCCAGAGCTTGATCAACATTAAGAATGGGCTCTCCGTCCTGCCCTCAGATTCCATACTGTACGACAACAAC
ATCACCAAATCCGTTGTCGATTTCTACAGTGTCGACAAATCCTCATTTGCAGAGGATTTTGCGGTGGCTATGATCAAAATGGGTAGAATCGACGTCAATACGGGAACCGAGGGAGAAATA
CGGCAAGTCTGCGAAACTGTGAATCCAA
GTCAGATTTGCCCCCCATTCACTTCAACGGGCTCTAGGCTGATATCAGACCACCTTTTATTGGCCTTACTATTTTTAGTATTGTTTTGTTTT
TATTAGTGTTTTTACTCTATCTGCAGAGTGCAGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTCAAGAAGCGAACTTCAAGTTGGCTTCTACTCCGACAAGTGTCCATTCGCGGAGGCGACCGTCGAGGCTGCTGTGGTGGACGCTGCGGTAGTCAACCCTAGGGTTGCCCCGATT
CTGCTCCGCCTTCATTTCCACGACTGCTTCGTGGAG
GGCTGTGATGGATCCATACTGATTACAACCGGCGTACAGGATGCTGAAATTAGTGCATCCGCACACCAAGGGGTAATGGGGTTC
GACGTGATCGCGAAAGCGAAAGCGGCAATCGAAGCTCAGTGCCCGGGGGTCGTGTCGTGCGCTGATATCGTGGCGATTGCCGCTAGGGATGCCGTCGCCTTG
GCCGGAGGTCCGACTTAT
GAGGTCGAGACCGGTAGAAGAGACGGTAGGCTTTCCAGTGCAAATATGGCATGGCGCATGCCACAATTTCACGATTCCGTCCACACGCTTCGGTTAAAGTTCTTCGAGAAAGGACTCACC
GAAGCCGATCTCGTCTTGCTAAGTG
GGGGAGCACATACGATCGGTACTACAGCCTGTTTTTTCGTCAGAGACAGGCTGTACGCCTTCATGGGTACAAATACATCCGATCCAACAATTAGC
CCCGCTCTGCTACCTTCACTAGAGCGCCAGTGCCCAAAGGACGGAAGTCCAATGGATCGACTACTTCTCGATCAAGTGACTGGAGAAAGATTCGACGTCCAGAGCTTGATCAACATTAAG
AATGGGCTCTCCGTCCTGCCCTCAGATTCCATACTGTACGACAACAACATCACCAAATCCGTTGTCGATTTCTACAGTGTCGACAAATCCTCATTTGCAGAGGATTTTGCGGTGGCTATG
ATCAAAATGGGTAGAATCGACGTCAATACGGGAACCGAGGGAGAAATACGGCAAGTCTGCGAAACTGTGAATCCAA
TGTTTTTACTCTATCTGCAGAGTGCAGAGTAA

Retrieve as FASTA