Entry information : MguPrx76 (mgv1a019228m)
Entry ID 9235
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx76 (mgv1a019228m)
Name (synonym) MguPrx76 (mgv1a019228m)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx76
start..stop
S start..stop
SaPrx32 479 4e-172 17..331 19..327
NtPrx81-1A 460 1e-164 3..331 1..320
CroPrx32 456 7e-163 3..331 2..327
CcampPrx36 452 2e-161 5..331 5..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 858500..858724 225 N° 2 858175..858360 186 N° 3 857945..858107 163 N° 4 856812..857230 419
complement(join(856812..857230,857945..858107,858175..858360,858500..858724))


exon

Literature and cross-references MguPrx76 (mgv1a019228m)
DNA ref. Phytozome 12:   scaffold_89 (858724..856812)
Protein sequence: MguPrx76 (mgv1a019228m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (315)
PWM (Da):   %s   35588.75 (33796.7)  
PI (pH):   %s   5.64 (5.38) Peptide Signal:   %s   cut: 23 range:17-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
FRILVALVIIITSYCSFDVSQGGGGGNNQLRVGFYGGSCPNAEAIIRGVVSEAAASDPNNAPILLRLHFHDCFVEGCDGSILIDNRSETDERRAFGHQGVRGFDIIDKAKAQLEGVCPGVVSCADIVAMAARDAVFLAKGPWYEVETGRRDGMVSNIRLADNMPDVGDSIHKLKAKFFEKGLTDKDLVLLSSAHTIGTTACFFMNDRLYHFPAGIGGADPSINPSFMPELKNTCPEKGDVNARIPIDHGSEKTFDNQILQNIRSGFAVLQSDARLYQDPSTRSVVDSYFGLLSPFFGPSFEADFAASMVKMGRIGVLTGELGTIRRVCSS

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTCGGATATTAGTAGCACTTGTGATTATTATTACAAGTTATTGTTCATTTGATGTCTCACAAGGCGGCGGCGGCGGCAACAACCAGCTCCGAGTGGGGTTCTATGGCGGCAGCTGCCCC
AACGCCGAGGCTATAATCCGCGGCGTTGTCAGCGAAGCCGCCGCCTCCGACCCAAACAACGCCCCCATCTTGCTCCGGCTTCACTTCCACGACTGCTTCGTTGAG
GTCATTTTCGAATTC
TCACACTTAATTGCTTCGTTGAGGTCATTTTCGAATTCTCACACTACTATGAAGAAAAAAAACTTGAATATTTTTTTTGAGCAAATATGATATAATGATATATATGTAAGTATATTATAT
TCAGGGATGCGACGGGTCGATTCTGATAGATAACCGTTCAGAAACAGACGAGAGACGAGCTTTTGGACACCAAGGGGTGCGAGGGTTCGATATAATAGACAAGGCGAAGGCTCAACTCGA
AGGCGTTTGCCCCGGGGTTGTTTCTTGTGCTGATATAGTTGCTATGGCCGCCAGAGATGCTGTTTTCTTG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTGTAGGCAAAAGGGCCGTGGTACGAGGTTGAAACAGGGAGGAGAGATGGTATGGTGTCGAATATAAGGTTGGCTGATAATATGCCAGATGTCGGTGATTCTATTCACA
AACTCAAAGCCAAGTTTTTTGAGAAGGGCCTTACGGACAAGGATCTTGTGCTTCTTAGTT
GTATGTATTCTTGTATCTATATATTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGAGGCAGCATTCGCATGGTAGTACGGTAATACATGCAGAGTTTGTGGCCTTTGTAGTCGGTGGGCATCCGAATCATATGATATGAGTTCGTCGGGTGGANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
TAAATGTTTGACACTATCATAAACATTCTTTCTGGCAAACTCAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTGTTGTAATTTTTGTTTTATAATCTTAGCCGCGCACACAATCGGAACCACGGCGTGCTTCTTCATGAACGATAGGCTCTACCACTTTCCGGCCG
GCATTGGGGGCGCCGACCCCTCCATAAACCCTAGCTTCATGCCGGAGTTAAAAAACACGTGCCCAGAGAAAGGTGACGTCAACGCTCGGATTCCAATAGACCACGGCAGCGAGAAGACAT
TCGACAACCAAATACTGCAGAACATCCGATCGGGCTTCGCCGTGCTGCAATCGGACGCCAGGCTGTACCAAGATCCGTCCACGAGAAGCGTTGTGGACTCCTATTTCGGGCTGCTCAGCC
CGTTTTTCGGCCCGTCTTTCGAGGCCGATTTCGCTGCCTCGATGGTGAAAATGGGGAGGATCGGTGTTTTGACGGGAGAGCTCGGCACAATCCGGCGCGTTTGTTCGTCTTTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTCGGATATTAGTAGCACTTGTGATTATTATTACAAGTTATTGTTCATTTGATGTCTCACAAGGCGGCGGCGGCGGCAACAACCAGCTCCGAGTGGGGTTCTATGGCGGCAGCTGCCCC
AACGCCGAGGCTATAATCCGCGGCGTTGTCAGCGAAGCCGCCGCCTCCGACCCAAACAACGCCCCCATCTTGCTCCGGCTTCACTTCCACGACTGCTTCGTTGAG
GGATGCGACGGGTCG
ATTCTGATAGATAACCGTTCAGAAACAGACGAGAGACGAGCTTTTGGACACCAAGGGGTGCGAGGGTTCGATATAATAGACAAGGCGAAGGCTCAACTCGAAGGCGTTTGCCCCGGGGTT
GTTTCTTGTGCTGATATAGTTGCTATGGCCGCCAGAGATGCTGTTTTCTTG
GCAAAAGGGCCGTGGTACGAGGTTGAAACAGGGAGGAGAGATGGTATGGTGTCGAATATAAGGTTGGCT
GATAATATGCCAGATGTCGGTGATTCTATTCACAAACTCAAAGCCAAGTTTTTTGAGAAGGGCCTTACGGACAAGGATCTTGTGCTTCTTAGTT
CCGCGCACACAATCGGAACCACGGCG
TGCTTCTTCATGAACGATAGGCTCTACCACTTTCCGGCCGGCATTGGGGGCGCCGACCCCTCCATAAACCCTAGCTTCATGCCGGAGTTAAAAAACACGTGCCCAGAGAAAGGTGACGTC
AACGCTCGGATTCCAATAGACCACGGCAGCGAGAAGACATTCGACAACCAAATACTGCAGAACATCCGATCGGGCTTCGCCGTGCTGCAATCGGACGCCAGGCTGTACCAAGATCCGTCC
ACGAGAAGCGTTGTGGACTCCTATTTCGGGCTGCTCAGCCCGTTTTTCGGCCCGTCTTTCGAGGCCGATTTCGCTGCCTCGATGGTGAAAATGGGGAGGATCGGTGTTTTGACGGGAGAG
CTCGGCACAATCCGGCGCGTTTGTTCGTCTTTT

Retrieve as FASTA