Entry information : MguPrx77 (mgv1a019406m)
Entry ID 9236
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx77 (mgv1a019406m)
Name (synonym) MguPrx77 (mgv1a019406m)
Class Class III peroxidase    [Orthogroup: Prx089]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx77
start..stop
S start..stop
MguPrx102 496 1e-178 1..328 1..324
MguPrx44 479 4e-172 1..328 1..324
MguPrx84 479 4e-172 1..328 1..324
MguPrx39 474 3e-170 1..326 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 179964..180179 216 N° 2 180267..180455 189 N° 3 180581..180746 166 N° 4 181233..181648 416
join(179964..180179,180267..180455,180581..180746,181233..181648)


exon

Literature and cross-references MguPrx77 (mgv1a019406m)
DNA ref. Phytozome 12:   scaffold_52 (179964..181648)
Protein sequence: MguPrx77 (mgv1a019406m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   36037.31 (33130.8)  
PI (pH):   %s   9.77 (9.81) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFTYKHVIFNVLVLLSIFNTCHTEELKFGFYKNTCPSAEAIVKQETSRIISVAPSLAAAFLRMHFHDCFVRGCDGSVLLDSTRNNKAEKDSFPNLSLRGFGSIARVKSTVEKQCPGVVSCADILALLARDAISDKHGAFWPVRLGRRDGRVSKSSEVLANLPAPNFNISQLKASFASKGFTTKDLVVLSGAHTIGVSHCSSFSNRLYNFTGKGDSDPALESNYTAFLMRRCKRMDVGSLVEMDPRSYKVFDTSYYKAVANKKGLFTSDSSLLADGETRAYVTRHAATPDRGLKSFFGDFAKSMVKMSEIGVLTGNRGEIRKTCSFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACTTACAAGCACGTTATTTTTAATGTTCTTGTTCTCCTTAGCATATTCAACACGTGTCATACTGAAGAGTTGAAGTTTGGCTTCTACAAGAACACATGTCCATCTGCAGAG
GCTATCGTGAAACAAGAAACTTCTCGTATTATTTCCGTTGCTCCTTCCCTTGCCGCTGCTTTTCTCAGAATGCATTTCCATGACTGTTTTGTTAGG
GNNNNNNNNNNNNNNNNNNNNNNN
NNCATACCTTATACATATGCATGCATGTAAACGCTCAGTCGTAAGCTATATACATGTTTGCAGGGGTGTGATGGTTCTGTGCTACTAGATTCAACAAGAAACAATAAAGCTGAGAAAGAT
TCGTTTCCGAATCTATCCCTTAGAGGATTCGGATCCATCGCCAGAGTGAAATCCACCGTTGAAAAGCAGTGTCCAGGTGTCGTTTCTTGTGCCGATATATTAGCTCTTCTTGCACGTGAC
GCAATTTCAGAT
GTGAGTTGATAAAATTCAAATGGATCTCCATTTCTACCAAGTTAAAAAAAAACAAAAAAAAATTCGAAAAAAGGTATTTATATTCATGATTAATCAATAACTTGTTTA
AATATATTTGAGCGCAGAAGCACGGAGCTTTCTGGCCGGTACGTTTGGGACGGAGAGATGGAAGAGTGTCGAAGAGCTCCGAGGTGTTGGCTAATCTTCCGGCTCCTAATTTCAATATTA
GTCAGTTAAAAGCATCATTTGCTTCAAAGGGTTTCACCACAAAGGACCTTGTAGTTCTCTCAG
GTAATTATTAGAGCCTCGTCTCTTCCATCGCAACCGTTTAGGGCCCCGTCAGAGGCG
TACGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAAATGGTCGTGCATGCAGATAATTACTAAAATTACTCGTCAGGATACGCT
TTAGTACACACGTCCCGAATGAGTATAAGTGTTCGTCAAACTTTGTTCCTTAAACTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTACTTCAGTAGACTGAGCTGCTTTT
AATAATCAATATCGAATAGTTTCGTTCGATTATATTTTTAAACCCTCTCCTACCTCAATATGCATGTAGGAGCCCACACCATAGGAGTATCCCATTGCTCGAGCTTCTCTAACCGGCTAT
ACAACTTCACCGGCAAAGGAGATAGCGACCCGGCACTGGAGTCGAACTACACTGCATTTCTAATGAGAAGGTGCAAGCGAATGGATGTGGGATCGTTGGTTGAGATGGACCCGCGGAGCT
ATAAAGTGTTCGACACTTCGTACTACAAAGCTGTCGCGAACAAGAAAGGACTCTTCACTTCCGATTCGTCTCTTCTTGCTGACGGTGAGACTAGGGCTTATGTCACGCGCCATGCGGCTA
CTCCTGATCGCGGATTAAAGAGCTTCTTCGGAGATTTTGCCAAGTCTATGGTGAAAATGAGCGAAATCGGTGTTCTCACGGGGAACCGGGGTGAAATCAGGAAAACGTGTTCTTTTGTTA
ATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCACTTACAAGCACGTTATTTTTAATGTTCTTGTTCTCCTTAGCATATTCAACACGTGTCATACTGAAGAGTTGAAGTTTGGCTTCTACAAGAACACATGTCCATCTGCAGAG
GCTATCGTGAAACAAGAAACTTCTCGTATTATTTCCGTTGCTCCTTCCCTTGCCGCTGCTTTTCTCAGAATGCATTTCCATGACTGTTTTGTTAGG
GGGTGTGATGGTTCTGTGCTACTA
GATTCAACAAGAAACAATAAAGCTGAGAAAGATTCGTTTCCGAATCTATCCCTTAGAGGATTCGGATCCATCGCCAGAGTGAAATCCACCGTTGAAAAGCAGTGTCCAGGTGTCGTTTCT
TGTGCCGATATATTAGCTCTTCTTGCACGTGACGCAATTTCAGAT
AAGCACGGAGCTTTCTGGCCGGTACGTTTGGGACGGAGAGATGGAAGAGTGTCGAAGAGCTCCGAGGTGTTGGCT
AATCTTCCGGCTCCTAATTTCAATATTAGTCAGTTAAAAGCATCATTTGCTTCAAAGGGTTTCACCACAAAGGACCTTGTAGTTCTCTCAG
GAGCCCACACCATAGGAGTATCCCATTGC
TCGAGCTTCTCTAACCGGCTATACAACTTCACCGGCAAAGGAGATAGCGACCCGGCACTGGAGTCGAACTACACTGCATTTCTAATGAGAAGGTGCAAGCGAATGGATGTGGGATCGTTG
GTTGAGATGGACCCGCGGAGCTATAAAGTGTTCGACACTTCGTACTACAAAGCTGTCGCGAACAAGAAAGGACTCTTCACTTCCGATTCGTCTCTTCTTGCTGACGGTGAGACTAGGGCT
TATGTCACGCGCCATGCGGCTACTCCTGATCGCGGATTAAAGAGCTTCTTCGGAGATTTTGCCAAGTCTATGGTGAAAATGAGCGAAATCGGTGTTCTCACGGGGAACCGGGGTGAAATC
AGGAAAACGTGTTCTTTTGTTAATTGA

Retrieve as FASTA