Entry information : MguPrx78 ( mgv1a019681m)
Entry ID 9237
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-28 (Christophe Dunand)
Peroxidase information: MguPrx78 ( mgv1a019681m)
Name (synonym) MguPrx78 ( mgv1a019681m)
Class Class III peroxidase    [Orthogroup: Prx183]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx78
start..stop
S start..stop
MguPrx99 481 5e-173 1..323 6..328
MguPrx[P]104 481 1e-172 1..323 6..328
MguPrx37 288 5e-97 25..323 24..325
BstrPrx17 269 3e-89 7..323 16..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 95781..95993 213 N° 2 95317..95680 364 N° 3 94829..95229 401  
complement(join(94829..95229,95317..95680,95781..95993))


exon

Literature and cross-references MguPrx78 ( mgv1a019681m)
DNA ref. Phytozome 11:   scaffold_109 (95993..94829)
Protein sequence: MguPrx78 ( mgv1a019681m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (307)
PWM (Da):   %s   35820.11 (33759.0)  
PI (pH):   %s   6.51 (5.92) Peptide Signal:   %s   cut: 20 range:20-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLVVLFFILCGLNLKVNGDEEYGGLTFDFYNKTCPQLEKIVEDAISSMSKEDPRTPAALLRLLFNDCVVMGCDASILLDLKDRSKSEMGSFSNFGIKKRELIGQIKSMVDKVCPKQVSCADILVLAARESVAISQGPRIRVPLGRRDSTVAYTNFDADTHLPQVDSFLGYSLGKLRDLGGGMTDEEVVALLGAHTLGTSSCATIQYRVDFPGIIETDTNFVNKLRKTCPKGALSNYNTSLANDRTPYKFDNDYYSASFGGRSLLVIDATLTQDQRTVEQAGRFVTDQAYFFKMFSSAFVKLSVTQVLTGNDGEIRNQCNKLNRA

Retrieve as FASTA  
Remarks Complete sequence from genomic 'introns 1 and 3). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTAGTTGTTTTGTTTTTTATCTTATGTGGTTTAAATTTAAAAGTGAATGGAGATGAAGAATATGGAGGCTTGACCTTTGACTTTTACAATAAAACATGTCCGCAACTTGAAAAA
ATCGTCGAAGATGCAATTTCTTCGATGTCGAAAGAAGATCCTAGAACCCCTGCTGCTTTATTGAGGCTATTGTTTAACGATTGTGTGGTTATG
GTAAATATAAAATCCCTCCCTTGTTAA
AAGAAAATTCAAAATTTTTTTTGAGAAGATTATTATTGATCACTAATTCTTTGTGAATCGTAACTAATTTTAGGGTTGTGACGCTTCGATCCTTCTTGATTTGAAAGACAGGAGCAAATC
AGAAATGGGGTCGTTTAGTAATTTCGGTATCAAGAAAAGGGAGTTAATTGGGCAAATAAAATCAATGGTGGATAAAGTTTGTCCTAAACAGGTTTCGTGTGCTGATATTCTAGTCCTCGC
GGCTCGAGAATCTGTAGCTATTTCTCAAGGGCCGAGAATTCGAGTCCCACTTGGACGAAGGGATTCAACCGTTGCATATACCAATTTTGATGCAGATACCCACTTGCCTCAGGTCGATAG
TTTTCTTGGTTATTCGTTAGGTAAACTAAGAGACCTCGGTGGCGGAATGACCGACGAGGAAGTTGTTGCACTATTAG
GTAATCGATCGATCGTAGTTTTATTTATTTAATATTGAAGTTA
CACTACATATATAATTAATTAACGTATTAATATTGTGATTGTAGGTGCACATACACTTGGTACTTCTAGTTGCGCAACAATTCAATATCGTGTAGACTTTCCGGGCATCATAGAAACTGA
TACAAATTTTGTGAACAAGTTACGGAAAACTTGCCCCAAGGGGGCTTTATCCAACTACAATACATCCCTAGCTAATGATCGTACACCTTATAAATTTGACAACGACTATTATTCGGCTTC
GTTTGGAGGAAGAAGTCTATTGGTGATTGATGCAACATTAACTCAAGATCAAAGAACCGTTGAACAAGCTGGGAGATTCGTTACCGACCAAGCATATTTCTTTAAAATGTTTTCGTCTGC
CTTTGTTAAGCTTTCTGTCACACAAGTTCTTACCGGAAACGATGGAGAAATTAGAAACCAATGTAATAAGTTGAATCGAGCTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCATTAGTTGTTTTGTTTTTTATCTTATGTGGTTTAAATTTAAAAGTGAATGGAGATGAAGAATATGGAGGCTTGACCTTTGACTTTTACAATAAAACATGTCCGCAACTTGAAAAA
ATCGTCGAAGATGCAATTTCTTCGATGTCGAAAGAAGATCCTAGAACCCCTGCTGCTTTATTGAGGCTATTGTTTAACGATTGTGTGGTTATG
GGTTGTGACGCTTCGATCCTTCTTGAT
TTGAAAGACAGGAGCAAATCAGAAATGGGGTCGTTTAGTAATTTCGGTATCAAGAAAAGGGAGTTAATTGGGCAAATAAAATCAATGGTGGATAAAGTTTGTCCTAAACAGGTTTCGTGT
GCTGATATTCTAGTCCTCGCGGCTCGAGAATCTGTAGCTATTTCTCAAGGGCCGAGAATTCGAGTCCCACTTGGACGAAGGGATTCAACCGTTGCATATACCAATTTTGATGCAGATACC
CACTTGCCTCAGGTCGATAGTTTTCTTGGTTATTCGTTAGGTAAACTAAGAGACCTCGGTGGCGGAATGACCGACGAGGAAGTTGTTGCACTATTAG
GTGCACATACACTTGGTACTTCT
AGTTGCGCAACAATTCAATATCGTGTAGACTTTCCGGGCATCATAGAAACTGATACAAATTTTGTGAACAAGTTACGGAAAACTTGCCCCAAGGGGGCTTTATCCAACTACAATACATCC
CTAGCTAATGATCGTACACCTTATAAATTTGACAACGACTATTATTCGGCTTCGTTTGGAGGAAGAAGTCTATTGGTGATTGATGCAACATTAACTCAAGATCAAAGAACCGTTGAACAA
GCTGGGAGATTCGTTACCGACCAAGCATATTTCTTTAAAATGTTTTCGTCTGCCTTTGTTAAGCTTTCTGTCACACAAGTTCTTACCGGAAACGATGGAGAAATTAGAAACCAATGTAAT
AAGTTGAATCGAGCTAAT

Retrieve as FASTA