Entry information : MguPrx79 (mgv1a019717m)
Entry ID 9238
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang LI)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx79 (mgv1a019717m)
Name (synonym) MguPrx79 (mgv1a019717m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx79
start..stop
S start..stop
VvPrx95 395 5e-138 5..348 11..366
LePrx106 396 1e-137 1..348 1..413
CroPrx46 395 1e-137 1..348 1..398
CsPrx02 379 3e-131 5..348 3..377
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1746477..1746803 327 N° 2 1747873..1748061 189 N° 3 1748159..1748321 163 N° 4 1748580..1748676 97
N° 5 1748812..1749079 268  
join(1746477..1746803,1747873..1748061,1748159..1748321,1748580..1748676,1748812 ..1749079)


exon

Literature and cross-references MguPrx79 (mgv1a019717m)
DNA ref. Phytozome 12:   scaffold_7 (1746477..1749079)
Protein sequence: MguPrx79 (mgv1a019717m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   38637.48 (35728.8)  
PI (pH):   %s   5.68 (4.98) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDFTRKLSFVVFILCVLISLKKKQADINRRGCVASDSPPPLQAPPSHRKLQQNDGGENVLPEGIRYDYYNESCPSAEQIIRSTVQELYEFRPDVAPALLRLAFHDCFVKGCDASILLDPTNSTASEKEAFPNQSLRGFDVIDIIKSEVEEACPGVVSCADIVVLAARESVLVAGGPFYPLLTGRKDNKEGSLDEANRLPSPQDHLYETLHKFQPKGFTERETITLLGAHSVGTIHCSFFNERLFNFKGSNAPDPSIDADSSQNPGMKMDYEGPRKDFGTLYYRSLLQRKGLLFVDQQLTSMAEAQVWVQAYASDLSLFKRDFGLAMMKLSNLHLLNASVGEVRLNCR

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTTCACCAGAAAACTGAGCTTCGTCGTTTTCATACTCTGCGTTCTGATTTCCCTGAAAAAAAAGCAGGCAGATATCAATAGAAGGGGTTGCGTCGCTTCGGACTCACCGCCTCCT
CTCCAAGCTCCGCCGTCTCATCGGAAGCTGCAGCAGAACGACGGTGGCGAGAATGTCCTCCCCGAAGGAATCAGATACGATTACTACAACGAATCCTGCCCTTCAGCTGAGCAAATCATC
CGATCTACCGTTCAAGAGCTGTACGAGTTTCGCCCCGATGTAGCCCCTGCTTTACTGAGGCTCGCCTTTCACGACTGCTTCGTCAAG
GTGACTCGAATTTTTATTTATTTATTTTCCTTC
CAATTCTTCCATTATCCGTTTTTGGTTTTGTATTAGTGGTTGATGATACCTTTTGGGGGCTGAATTAAGTCTGATTTTGTGGAGGTGAACAATTTAATCATCTCGTGATAAGATCTCTGC
TGCTTTTTGCTTTTTCTCATTTGATACCGTTTTGGGGCAGAACTCGTTCTAGGTTTGTACTGAATTCTAGGGTTGTGCATGAACTATTTGATTCAGTTTTTACTCACCTTTATTCAGAGT
GTTTTAGTTCATGGTGAGGAGAAGATTTATGGTGTTTCTTCTATGTTTTGGGGATGAATTCACTGCGGTTTTCTCCTACATTCCTAGGGCTTTGTTTGCTCAAGAGTTTGTGTAATTTCA
TTACTGATTTGTGTATGAGCTCTTTGATTCATTTTTGACTCGATGGTATTCAATGTTTTAATTCATCGTGATGAGATTTTTGCTGTTTTTCTACGTTTTGGGGATGAATTCTCTGTAGTT
TGCGTATTTGAGGTTCGATTTAATTGCATTTCCTTGGCTCTTTGATTCAGTTTTGGCACGATGATATTCAAGGTTTCATTTTATCGTGATGAGATTTTAGCCGTTTTCCTACGTTTTGGG
ATGAATTCGCTGTAGTTTTTCATATTGAAGGCTCACTTTAATTAAATTTCCTGGGCTCTTTGATTCAGTTTTGACTCTATGATATTGAAGGTTTTATTTCACCGTGATGAATTTTTTTGC
CGTTTTTCTACGTATTGGGGATGAATTCTCTGTAGTCTTCTCCTGGATCCCTAGGGGTTTGTTTGCTCAACAGTTAGTGTGATTGCATTACTGATTACTGATTGGGCATGGGATCTTTGA
TTTGTTTTTTACTCGGTTTTATTTCATTTGACGGCATCTTTTGCTTCGAGAAGAATTTGAATGGTCTAATTTATATTAGTTCCGAAATAGGCTTGTCTAGTTTTCATGAATTTAATGTGG
TTTCCCCCAAGTCACTTCTATATATGCATATACAGTAGTAGTTTCTTAAATGGTTTCTGCCGTATATTACTTGTAGGGTTGTGATGCCTCAATTTTATTGGATCCTACCAATTCAACCGC
TAGCGAGAAAGAGGCTTTTCCTAATCAATCTCTGAGGGGATTTGATGTGATTGACATTATCAAGTCAGAAGTCGAAGAAGCATGCCCTGGAGTTGTTTCTTGTGCTGATATAGTGGTTCT
TGCTGCAAGAGAAAGCGTTCTCGTG
GTAACTTATATTAACTCCTTTCTCTTGCGTTTGTTTTGTGTGTGGTGAATCTATATGTATATATCCATTAAATTTCTTGTGATCTTTCGAGTTCC
AGGCTGGGGGGCCATTCTATCCTCTGTTGACCGGTAGGAAGGACAACAAAGAAGGTTCTCTAGATGAAGCTAATAGACTTCCCAGTCCTCAAGATCATCTCTATGAAACACTTCACAAAT
TTCAACCAAAAGGGTTTACTGAGAGAGAGACAATCACTCTACTAG
GTATATTACATTCATACTCTTTTTTCATGACAAGGAAATTAGTATGTTTGATTACCTCAAAGCTGGGGATGCCAA
TCTCTTTAAAATGCAGCATATAGTTTAAAAAATATGACATGATCAATAATGTAGTTTTGTATATACTCTATATGCTTGTATGATTGTTGTTTCTAGCCTTCAGCATTCATACATCTTTCC
GCAACCTATGCAGAGGATTTTTTTTCGTTCTTCTTACTTTATTTTTCCTCTACTTGTACATAGGTGCCCACAGTGTCGGAACCATCCACTGCAGCTTTTTTAATGAGCGGCTGTTTAACT
TCAAGGGAAGTAATGCACCTGACCCTTCGATAGATGCTGA
GTTTCTTGGTGTTCTGAGATCAAAATGCAATAGCAGCCACTCAAGATCAGCTTCACAATCCGCTTCGGCATACTATTCAC
CATACTATTCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGAAAATAGCTCGTCTCAGAATCCAGGAATGAAGATGGACTACGAAGGACCTAGAAAAGATTTTGGCACACTAT
ACTACCGCAGTCTATTGCAACGCAAAGGATTACTGTTTGTTGATCAGCAGCTGACATCCATGGCTGAAGCCCAGGTTTGGGTCCAAGCATATGCCTCGGATTTATCCCTCTTCAAGAGAG
ATTTTGGACTTGCAATGATGAAGCTCTCCAACCTCCATCTTCTGAATGCATCGGTCGGTGAAGTTCGACTCAATTGCCGAAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATTTCACCAGAAAACTGAGCTTCGTCGTTTTCATACTCTGCGTTCTGATTTCCCTGAAAAAAAAGCAGGCAGATATCAATAGAAGGGGTTGCGTCGCTTCGGACTCACCGCCTCCT
CTCCAAGCTCCGCCGTCTCATCGGAAGCTGCAGCAGAACGACGGTGGCGAGAATGTCCTCCCCGAAGGAATCAGATACGATTACTACAACGAATCCTGCCCTTCAGCTGAGCAAATCATC
CGATCTACCGTTCAAGAGCTGTACGAGTTTCGCCCCGATGTAGCCCCTGCTTTACTGAGGCTCGCCTTTCACGACTGCTTCGTCAAG
GGTTGTGATGCCTCAATTTTATTGGATCCTACC
AATTCAACCGCTAGCGAGAAAGAGGCTTTTCCTAATCAATCTCTGAGGGGATTTGATGTGATTGACATTATCAAGTCAGAAGTCGAAGAAGCATGCCCTGGAGTTGTTTCTTGTGCTGAT
ATAGTGGTTCTTGCTGCAAGAGAAAGCGTTCTCGTG
GCTGGGGGGCCATTCTATCCTCTGTTGACCGGTAGGAAGGACAACAAAGAAGGTTCTCTAGATGAAGCTAATAGACTTCCCAGT
CCTCAAGATCATCTCTATGAAACACTTCACAAATTTCAACCAAAAGGGTTTACTGAGAGAGAGACAATCACTCTACTAG
GTGCCCACAGTGTCGGAACCATCCACTGCAGCTTTTTTAAT
GAGCGGCTGTTTAACTTCAAGGGAAGTAATGCACCTGACCCTTCGATAGATGCTGA
CTCGTCTCAGAATCCAGGAATGAAGATGGACTACGAAGGACCTAGAAAAGATTTTGGCACACTA
TACTACCGCAGTCTATTGCAACGCAAAGGATTACTGTTTGTTGATCAGCAGCTGACATCCATGGCTGAAGCCCAGGTTTGGGTCCAAGCATATGCCTCGGATTTATCCCTCTTCAAGAGA
GATTTTGGACTTGCAATGATGAAGCTCTCCAACCTCCATCTTCTGAATGCATCGGTCGGTGAAGTTCGACTCAATTGCCGAAAA

Retrieve as FASTA