Entry information : SbPrx118 (Sobic.009G113700.1 [2.1] / SB09G018150 [1.4])
Entry ID 924
Creation 2006-01-06 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx118 (Sobic.009G113700.1 [2.1] / SB09G018150 [1.4])
Name (synonym) SbPrx118 (Sobic.009G113700.1 [2.1] / SB09G018150 [1.4])
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Roots
Inducers Acid treatment
Alkaline treatment
Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx118
start..stop
S start..stop
TaPrx67 505 0 1..338 1..340
SiPrx92 489 9e-176 17..339 23..337
OsPrx116 439 6e-156 11..339 4..330
StPrx04 434 4e-154 34..339 25..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 45552777..45552843 67 N° 2 45552926..45553884 959  
join(45552777..45552843,45552926..45553884)


exon

Literature and cross-references SbPrx118 (Sobic.009G113700.1 [2.1] / SB09G018150 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_9 (45552777..45553884)
Cluster/Prediction ref. UniGene:   Sbi.7693
Protein sequence: SbPrx118 (Sobic.009G113700.1 [2.1] / SB09G018150 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (315)
PWM (Da):   %s   36567.09 (33918.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.59 (6.42) Peptide Signal:   %s   cut: 27 range:27-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSSSSLVLFSAALLLFCCFTTGAAADAGGDGGLRLGYYSGSCPRAEDIVKEQVTQLYHKHGNTAVSWLRALFHDCFVRSCDASLLLDPTAATGGASEKASPRSFGMRNFKYVDVIKAAVERECPGTVSCADVLALAARDGAAILGGPRAVRMRTGRRDSLESHYAEVERDIPNHNDSVSAVLARFAAVGVDAEGAVALLGAHSVGRVHCSNLVARLYPTVDAGVDPGYGEYLRGRCPTADAGEEEDTRDVAYARNDRATPMVLDNMYYKNLLARRGLLLVDQRLADDPRTAPFVARMAADNAYFHDRFAAALLTMSEYNPLGDGEGEIRRHCRFVNSAAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, intron 5') and 5 ESTs. Containing IntR (5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAGCTCAAGCAGCCTAGTGCTGTTCTCTGCTGCTCTGCTCCTCTTCTGCTGCTTCACCACTGGTAACAATTCATAGATTCACATCTGTGAAAACTTTAACATTGAGATCGATCGA
CCCAGTAAGTTAACCTGATGATCCTGCAGGCGCGGCGGCGGACGCCGGCGGCGATGGTGGTCTTCGGCTGGGCTACTACTCGGGGAGCTGCCCGCGAGCCGAGGACATCGTCAAGGAGCA
GGTGACGCAGCTGTACCACAAGCACGGCAACACGGCGGTGTCATGGCTGCGCGCCCTGTTCCACGACTGCTTCGTGAGGTCCTGCGACGCCTCGCTGCTCCTGGATCCCACGGCGGCCAC
CGGCGGCGCCTCCGAGAAGGCCTCCCCGCGGAGCTTCGGCATGCGGAACTTCAAGTACGTCGACGTGATCAAGGCGGCGGTGGAGCGGGAGTGCCCCGGCACCGTCTCCTGCGCCGACGT
GCTGGCCCTGGCGGCGCGCGACGGCGCCGCCATCCTGGGCGGCCCGCGCGCGGTGCGCATGCGCACGGGGCGGCGGGACAGCCTGGAGAGCCACTACGCCGAGGTGGAGCGCGACATCCC
CAACCACAACGACAGCGTGTCGGCGGTGCTGGCCCGGTTCGCGGCCGTAGGCGTGGACGCCGAGGGCGCCGTGGCGCTGCTGGGCGCGCACTCCGTCGGCCGCGTGCACTGCTCCAACCT
GGTGGCGCGGCTGTACCCGACGGTGGACGCCGGCGTCGACCCGGGATACGGGGAATACCTCCGGGGGCGGTGCCCGACGGCGGACGCCGGCGAGGAGGAGGACACGCGCGACGTGGCGTA
CGCGCGCAACGACCGCGCCACGCCCATGGTGCTGGACAACATGTACTACAAGAACCTGCTGGCGCGGCGGGGGCTCCTCCTGGTGGACCAGCGGCTCGCCGACGACCCCCGCACGGCGCC
CTTCGTCGCAAGGATGGCCGCCGACAACGCCTACTTCCACGACCGCTTCGCCGCCGCGCTGCTCACCATGTCGGAGTACAACCCGCTGGGCGACGGAGAGGGGGAGATCAGGCGCCACTG
CAGGTTCGTCAATTCAGCAGCAGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAGCTCAAGCAGCCTAGTGCTGTTCTCTGCTGCTCTGCTCCTCTTCTGCTGCTTCACCACTGGCGCGGCGGCGGACGCCGGCGGCGATGGTGGTCTTCGGCTGGGCTACTACTCG
GGGAGCTGCCCGCGAGCCGAGGACATCGTCAAGGAGCAGGTGACGCAGCTGTACCACAAGCACGGCAACACGGCGGTGTCATGGCTGCGCGCCCTGTTCCACGACTGCTTCGTGAGGTCC
TGCGACGCCTCGCTGCTCCTGGATCCCACGGCGGCCACCGGCGGCGCCTCCGAGAAGGCCTCCCCGCGGAGCTTCGGCATGCGGAACTTCAAGTACGTCGACGTGATCAAGGCGGCGGTG
GAGCGGGAGTGCCCCGGCACCGTCTCCTGCGCCGACGTGCTGGCCCTGGCGGCGCGCGACGGCGCCGCCATCCTGGGCGGCCCGCGCGCGGTGCGCATGCGCACGGGGCGGCGGGACAGC
CTGGAGAGCCACTACGCCGAGGTGGAGCGCGACATCCCCAACCACAACGACAGCGTGTCGGCGGTGCTGGCCCGGTTCGCGGCCGTAGGCGTGGACGCCGAGGGCGCCGTGGCGCTGCTG
GGCGCGCACTCCGTCGGCCGCGTGCACTGCTCCAACCTGGTGGCGCGGCTGTACCCGACGGTGGACGCCGGCGTCGACCCGGGATACGGGGAATACCTCCGGGGGCGGTGCCCGACGGCG
GACGCCGGCGAGGAGGAGGACACGCGCGACGTGGCGTACGCGCGCAACGACCGCGCCACGCCCATGGTGCTGGACAACATGTACTACAAGAACCTGCTGGCGCGGCGGGGGCTCCTCCTG
GTGGACCAGCGGCTCGCCGACGACCCCCGCACGGCGCCCTTCGTCGCAAGGATGGCCGCCGACAACGCCTACTTCCACGACCGCTTCGCCGCCGCGCTGCTCACCATGTCGGAGTACAAC
CCGCTGGGCGACGGAGAGGGGGAGATCAGGCGCCACTGCAGGTTCGTCAATTCAGCAGCAGCATGA

Retrieve as FASTA