Entry information : MguPrx84 ( Migut.M00405 / mgv1a021569m)
Entry ID 9242
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2013-12-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: MguPrx84 ( Migut.M00405 / mgv1a021569m)
Name (synonym) MguPrx84 ( Migut.M00405 / mgv1a021569m)
Class Class III peroxidase    [Orthogroup: Prx089]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx84
start..stop
S start..stop
MguPrx44 660 0 1..324 1..324
MguPrx[P]72 652 0 1..324 1..324
MguPrx39 651 0 1..322 1..322
MguPrx36 645 0 1..322 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6539424..6539633 210 N° 2 6538946..6539134 189 N° 3 6538683..6538848 166 N° 4 6538191..6538600 410
complement(join(6538191..6538600,6538683..6538848,6538946..6539134,6539424..6539 633))


exon

Literature and cross-references MguPrx84 ( Migut.M00405 / mgv1a021569m)
DNA ref. Phytozome 12:   scaffold_13 (6539633..6538191)   scaffold_52 (123925..125367)
Protein sequence: MguPrx84 ( Migut.M00405 / mgv1a021569m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (302)
PWM (Da):   %s   34989.79 (32432.5) Transmb domain:   %s   i7-25o
PI (pH):   %s   9.1 (9.07) Peptide Signal:   %s   cut: 23 range:23-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKQILVFLVFVGIFNTCNAQGLKLGFYKKTCPSVEAIVKKETANIMSVAPTLAAPILRMHFHDCFVRGCDASILLNSTTNNQAEKDSFPNLSLRGYGSIDRVKSAVEKKCPGVVSCADILALVARDAVSFLNGASWPVPLGRRDGNVSNSTETLFNLPPPFFNITQLKASFASKGLNAKDLVVLSGGHTIGTSHCSSFTNRLYNFTGVGDSDPSLDSNYVARLKTRCSATDTTTLVEMDPGSFKTFDTEYYTLVAKRRGLFTSDAALLADSETRAYVTSHATPQGSKDFLKDFAKSMVKMGKIGVLTGSQGEIRKTCGFIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTTTTCGTTGGAATATTCAACACATGTAATGCTCAAGGATTGAAACTTGGCTTCTACAAGAAAACTTGTCCATCAGTTGAGGCAATC
GTGAAAAAAGAAACTGCAAATATTATGTCCGTCGCTCCAACTCTTGCTGCTCCTATTCTCAGAATGCATTTCCACGATTGTTTCGTTAGA
GTATGTTTTCTTAAGCTCTATCTCCTCTTA
TATTTATATTCTCTTCATAACTACTTAATGGGTATATTTTACTATTACTATCAATGTTTGTAAGTATTTTTTGCTTACTTTACAATCGGAATCCTACTCATATTCATACACCTCTACCTT
CCTAATGGAGGGTGAGAACTGATTTAATCATATGGTTGGGAGTGGCATTTTAGAGCACTGCATAAACAATATTCTAAGTAACTTCTAGACGAAGTTAAGTACAATTGAGAGGTACTAATT
AGTTACTTATTACATACAGGGTTGTGACGCTTCTATTCTACTGAACTCAACAACAAATAATCAAGCTGAGAAAGATTCATTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAG
AGTGAAATCCGCAGTTGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCTGATATATTAGCTCTTGTTGCACGAGATGCAGTTTCATTT
GTAAGTACTGAAGATGATTATATATGTATATA
TAAAAATAAAATTTTGTTTATACAAAATTATACTTATTTATTTGAATGTATATATTGTAAATTAGTTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAA
ACAGCACAGAAACTTTGTTCAATCTTCCACCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATGCAAAGGATCTTGTTGTTCTCTCCG
GTAATAATC
ATTTATCACTTATTTTATTAATTAATTACATTATTTTTTTTTAAATTTTGTTCTAAAAACCCTAAATTTGCAGGAGGACACACCATAGGAACATCCCACTGCTCGAGTTTCACTAACCGC
CTGTACAACTTCACCGGCGTCGGAGACAGTGACCCTTCGTTGGACTCGAACTATGTTGCTCGTTTGAAGACAAGATGCAGTGCGACCGATACCACTACACTTGTTGAAATGGACCCCGGA
AGCTTTAAAACATTCGATACCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCCGACAGTGAAACTAGGGCTTACGTCACCAGCCATGCT
ACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTTAAAATGGGCAAGATTGGTGTTTTAACAGGGAGTCAAGGTGAAATTCGGAAAACATGTGGTTTCATTAAT
TAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAGTAAGCAAATTCTTGTATTTCTTGTTTTCGTTGGAATATTCAACACATGTAATGCTCAAGGATTGAAACTTGGCTTCTACAAGAAAACTTGTCCATCAGTTGAGGCAATC
GTGAAAAAAGAAACTGCAAATATTATGTCCGTCGCTCCAACTCTTGCTGCTCCTATTCTCAGAATGCATTTCCACGATTGTTTCGTTAGA
GGTTGTGACGCTTCTATTCTACTGAACTCA
ACAACAAATAATCAAGCTGAGAAAGATTCATTCCCCAATCTATCCCTTAGAGGATATGGATCCATCGACAGAGTGAAATCCGCAGTTGAGAAGAAGTGCCCCGGTGTTGTTTCTTGTGCT
GATATATTAGCTCTTGTTGCACGAGATGCAGTTTCATTT
TTGAATGGAGCATCGTGGCCAGTACCATTGGGAAGAAGAGATGGAAATGTATCAAACAGCACAGAAACTTTGTTCAATCTT
CCACCTCCTTTCTTCAACATCACTCAATTGAAAGCTAGCTTTGCCTCAAAGGGTTTGAATGCAAAGGATCTTGTTGTTCTCTCCG
GAGGACACACCATAGGAACATCCCACTGCTCGAGT
TTCACTAACCGCCTGTACAACTTCACCGGCGTCGGAGACAGTGACCCTTCGTTGGACTCGAACTATGTTGCTCGTTTGAAGACAAGATGCAGTGCGACCGATACCACTACACTTGTTGAA
ATGGACCCCGGAAGCTTTAAAACATTCGATACCGAGTATTACACTCTTGTTGCTAAAAGAAGAGGACTTTTCACATCTGACGCAGCTCTTCTTGCCGACAGTGAAACTAGGGCTTACGTC
ACCAGCCATGCTACTCCTCAAGGGTCAAAGGATTTCTTGAAGGACTTTGCAAAGTCAATGGTTAAAATGGGCAAGATTGGTGTTTTAACAGGGAGTCAAGGTGAAATTCGGAAAACATGT
GGTTTCATTAATTAA

Retrieve as FASTA