Entry information : MguPrx88 (mgv1a022021m)
Entry ID 9246
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-08 (Qiang Li)
Peroxidase information: MguPrx88 (mgv1a022021m)
Name (synonym) MguPrx88 (mgv1a022021m)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx88
start..stop
S start..stop
CroPrx18 565 0 17..341 1..324
SaPrx46 563 0 22..341 22..340
LePrx50 535 0 9..341 9..347
CroPrx17 530 0 13..334 2..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1576187..1576429 243 N° 2 1576522..1576713 192 N° 3 1576806..1576971 166 N° 4 1577369..1577790 422
N° 5 1577851..1577868 18  
join(1576187..1576429,1576522..1576713,1576806..1576971,1577369..1577790,1577851 ..1577868)


exon

Literature and cross-references MguPrx88 (mgv1a022021m)
DNA ref. Phytozome 12:   scaffold_37 (1576187..1577868)
Protein sequence: MguPrx88 (mgv1a022021m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (316)
PWM (Da):   %s   38090.33 (35009.7)  
PI (pH):   %s   7.31 (6.73) Peptide Signal:   %s   cut: 31 range:31-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSSLYSKGLILHGLILAICTSLSILHASEGPTLTLDYYKSTCPTILEIVRKEMECAVLSDPRNAALILRLHFHDCFVQGCDGSVLLDDTITLRGEKKAPNNRNALKGFRIVDRIKNRLESECPGIVSCADILTVAARDAVLLVGGPYWDVPLGRKDSKTAGYALTETNLPKADDGLIFIISKFFYQGLSVTDMVALSGAHTIGMARCVNFRNRIYGDFTSTSSVNPLSQQYLNKLKSICPPIKGSDNNESAMDYVSPNLFDNSYYQILLRGDGLINSDQELYSSFLAMETKKLVSKYAENPIAFFEQFSESMVKMGNITNPDTYANGEVRKICRFVNKSLFF*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCATCTTCGTCTCTTTACTCGAAAGGGCTAATTCTGCATGGCTTAATACTAGCAATCTGCACATCCCTTTCCATCTTGCATGCAAGTGAGGGCCCCACTTTAACCCTAGACTAC
TACAAATCCACATGCCCAACAATTCTCGAAATCGTTCGGAAAGAAATGGAATGTGCAGTGCTGTCTGATCCACGCAATGCAGCCTTAATCCTCCGGTTACATTTCCACGATTGCTTTGTC
CAG
GTCATCTTCTTCGTAAAATATAGTTCGTATAATTTTTGTGCGTATTATAAATTTTTTTAGGTTTTCTTTTAATACGAATGTAATGGATGCAGGGGTGTGATGGGTCGGTTTTGCTAG
ACGATACGATCACACTTCGAGGAGAGAAAAAGGCGCCTAATAACAGAAATGCCCTTAAAGGATTTAGAATAGTCGACAGGATCAAGAACAGGCTCGAATCCGAGTGCCCTGGAATAGTTT
CTTGTGCCGATATTCTCACCGTTGCTGCTAGAGATGCTGTTCTTCTC
GTAAATCACACAACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATATAGAGTAACATCAATTTGCT
ATGTTAATTCATTATTCAGGTTGGTGGACCTTATTGGGATGTTCCTCTGGGAAGGAAAGACTCGAAGACAGCTGGCTATGCCCTCACCGAAACGAACCTTCCGAAAGCTGACGACGGGCT
TATTTTCATTATTTCCAAGTTTTTTTATCAGGGCCTTTCGGTTACTGACATGGTGGCACTTTCTG
GTAATTAATTAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCGTACCTTTCTGTTGTACAAGGTTTTCAAAACTCAAAACAATGTCTTGTAGGGGCACATACAATCGGCA
TGGCAAGATGCGTAAATTTCAGGAACAGAATATACGGAGATTTTACGTCAACTTCAAGTGTAAATCCACTTTCACAGCAGTACCTCAACAAATTGAAATCTATTTGTCCGCCTATTAAAG
GATCAGACAACAACGAATCAGCAATGGATTACGTCTCTCCGAATTTATTCGACAACTCTTATTACCAAATACTTTTACGAGGAGATGGATTGATCAATTCGGATCAAGAATTATATTCCA
GTTTTCTAGCAATGGAAACGAAGAAGCTCGTTTCAAAATATGCAGAGAATCCGATCGCTTTTTTCGAGCAGTTCTCCGAATCCATGGTGAAAATGGGGAATATTACTAATCCTGATACTT
ACGCTAACGGAGAAGTTCGGAAAATCTGCAGGTTTGTGAATACA
TGAAGAGACACAAAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTGCAAGAGTTTGTTCTTTT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCATCTTCGTCTCTTTACTCGAAAGGGCTAATTCTGCATGGCTTAATACTAGCAATCTGCACATCCCTTTCCATCTTGCATGCAAGTGAGGGCCCCACTTTAACCCTAGACTAC
TACAAATCCACATGCCCAACAATTCTCGAAATCGTTCGGAAAGAAATGGAATGTGCAGTGCTGTCTGATCCACGCAATGCAGCCTTAATCCTCCGGTTACATTTCCACGATTGCTTTGTC
CAG
GGGTGTGATGGGTCGGTTTTGCTAGACGATACGATCACACTTCGAGGAGAGAAAAAGGCGCCTAATAACAGAAATGCCCTTAAAGGATTTAGAATAGTCGACAGGATCAAGAACAGG
CTCGAATCCGAGTGCCCTGGAATAGTTTCTTGTGCCGATATTCTCACCGTTGCTGCTAGAGATGCTGTTCTTCTC
GTTGGTGGACCTTATTGGGATGTTCCTCTGGGAAGGAAAGACTCG
AAGACAGCTGGCTATGCCCTCACCGAAACGAACCTTCCGAAAGCTGACGACGGGCTTATTTTCATTATTTCCAAGTTTTTTTATCAGGGCCTTTCGGTTACTGACATGGTGGCACTTTCT
G
GGGCACATACAATCGGCATGGCAAGATGCGTAAATTTCAGGAACAGAATATACGGAGATTTTACGTCAACTTCAAGTGTAAATCCACTTTCACAGCAGTACCTCAACAAATTGAAATCT
ATTTGTCCGCCTATTAAAGGATCAGACAACAACGAATCAGCAATGGATTACGTCTCTCCGAATTTATTCGACAACTCTTATTACCAAATACTTTTACGAGGAGATGGATTGATCAATTCG
GATCAAGAATTATATTCCAGTTTTCTAGCAATGGAAACGAAGAAGCTCGTTTCAAAATATGCAGAGAATCCGATCGCTTTTTTCGAGCAGTTCTCCGAATCCATGGTGAAAATGGGGAAT
ATTACTAATCCTGATACTTACGCTAACGGAGAAGTTCGGAAAATCTGCAGGTTTGTGAATACA
AAGAGTTTGTTCTTTTAA

Retrieve as FASTA