Entry information : MguPrx89 (mgv1a022139m)
Entry ID 9247
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-11 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-26 (Christophe Dunand)
Peroxidase information: MguPrx89 (mgv1a022139m)
Name (synonym) MguPrx89 (mgv1a022139m)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx89
start..stop
S start..stop
MguPrx300 712 0 1..344 1..344
StPrx300 435 5e-154 17..338 19..338
LePrx58 430 4e-152 17..338 19..338
CroPrx20 410 4e-144 1..338 3..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3942018..3942275 258 N° 2 3941695..3941874 180 N° 3 3941440..3941599 160 N° 4 3940699..3941135 437
complement(join(3940699..3941135,3941440..3941599,3941695..3941874,3942018..3942 275))


exon

Literature and cross-references MguPrx89 (mgv1a022139m)
DNA ref. Phytozome 12:   scaffold_2 (3942275..3940699)
Protein sequence: MguPrx89 (mgv1a022139m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   38292.97 Transmb domain:   %s   i5-24o
PI (pH):   %s   9.37
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGEGVNLVAICLVVALGLSLYVGRMQAAVTLPAEGKQLKRQFYKKMNTCVNAEAFVKHQVQLWWAKDKSITAKLLKLLYADCLVNGCDASILLEGPGTEKKAPQNRRLDGFALIDNIKRTVESRCPLVVSCADILNLAVRDALHLAGAPSYPVLLGRRDGKDSRATWVDLPPPSISWEKGVDYFKSKGLDEQDYATLLGAHTMGKAHCSSIYDRLYNWGNTKKPDPSMSKALLEKLRKQCPKVVVPKKDPTVFLTEKNGEQYRFTNNYYSNVLTQDSVLRADQELLYGYNTSQLVLEYAGSFEQLRRQFSLSISRLGGLKVLTGTDGEIRESCRFRNATEILH

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Containing motif 'YADC'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGAGAAGGGGTAAATTTGGTAGCAATATGCCTGGTGGTGGCGCTAGGGCTGAGCTTGTACGTGGGGCGGATGCAGGCGGCGGTTACATTGCCGGCGGAGGGGAAGCAGTTGAAG
AGGCAGTTCTACAAGAAGATGAACACGTGTGTCAACGCGGAGGCGTTCGTGAAGCATCAAGTGCAGTTGTGGTGGGCTAAAGACAAGTCCATCACCGCCAAGCTACTTAAGTTGCTCTAC
GCCGATTGTTTGGTCAAT
GTAAGTTCTTATATTTAGTTTCATTCTTAATAATATCAAATTAATGATGAGAAAGTAGTAGGATAAGTATAAATAATAATAATAATAAGGGTAAATCACGAA
AAAATATTCTCAACTTAGGCTAAATAACGAAAAACTTTCAGGGATGTGACGCATCAATTCTACTAGAGGGGCCCGGCACGGAAAAAAAGGCACCACAGAATCGACGGTTAGATGGGTTCG
CATTGATTGACAACATCAAGAGAACCGTTGAATCACGGTGCCCTTTAGTTGTCTCTTGTGCTGACATTCTTAATCTTGCTGTTCGTGATGCCCTTCACTTG
GTACGTAGTACTTATTTAT
ATACTTCAATTTCTTACTTATTAATTTATTACACGAGCACGATAAATTAATTAACCCTAAATCTAATCATCTGCAGGCAGGTGCACCATCATACCCAGTGTTGCTGGGTAGAAGAGACGG
AAAAGACTCGAGAGCAACATGGGTGGATCTTCCTCCGCCGTCGATTTCTTGGGAAAAGGGCGTTGACTACTTCAAATCCAAGGGCTTAGATGAACAGGATTACGCTACACTCCTAG
GTCA
TAATCACTAGTATATTAATTTTCCGTTCGAATTAAAAAATAAGTTGTTGGAAAACAAATAAAATATTTTAAAAATTTTTACCATTAATCTAACTTTTTATTTGAGATCTTATAATGAGTG
GAAATAGGATATAATAAGTTCATTATCCAAATATTTTAAAAATTAATTCTAAAATTAAGATGTAACAGTTTATTAGCTCTTAAAATATCTAATTAGATGTACGAACTTATCAGATTTTAA
AATAAGATTAGCCAAACGGGTCCTTTTTCATTAATTGAGTTAATTTTATTGTTGATTCAGGAGCGCACACGATGGGAAAAGCACACTGCTCATCGATTTACGACCGCCTCTACAACTGGG
GAAACACGAAGAAACCAGATCCGAGCATGAGCAAGGCCTTATTGGAAAAACTGAGGAAACAATGTCCGAAAGTAGTGGTACCGAAGAAGGATCCGACAGTATTCTTAACCGAAAAAAACG
GAGAACAGTACAGATTCACGAACAACTACTACTCCAACGTGCTGACTCAAGATTCGGTTCTTAGGGCCGACCAAGAGTTACTGTATGGATACAATACATCGCAGTTGGTGCTAGAATACG
CCGGCAGTTTCGAGCAGTTGAGGCGGCAGTTCTCATTGTCGATTAGCCGATTGGGCGGTCTCAAAGTCTTGACCGGTACCGATGGGGAGATTCGCGAGAGCTGTCGTTTCAGAAACGCCA
CTGAAATACTACACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGAGAAGGGGTAAATTTGGTAGCAATATGCCTGGTGGTGGCGCTAGGGCTGAGCTTGTACGTGGGGCGGATGCAGGCGGCGGTTACATTGCCGGCGGAGGGGAAGCAGTTGAAG
AGGCAGTTCTACAAGAAGATGAACACGTGTGTCAACGCGGAGGCGTTCGTGAAGCATCAAGTGCAGTTGTGGTGGGCTAAAGACAAGTCCATCACCGCCAAGCTACTTAAGTTGCTCTAC
GCCGATTGTTTGGTCAAT
GGATGTGACGCATCAATTCTACTAGAGGGGCCCGGCACGGAAAAAAAGGCACCACAGAATCGACGGTTAGATGGGTTCGCATTGATTGACAACATCAAGAGA
ACCGTTGAATCACGGTGCCCTTTAGTTGTCTCTTGTGCTGACATTCTTAATCTTGCTGTTCGTGATGCCCTTCACTTG
GCAGGTGCACCATCATACCCAGTGTTGCTGGGTAGAAGAGAC
GGAAAAGACTCGAGAGCAACATGGGTGGATCTTCCTCCGCCGTCGATTTCTTGGGAAAAGGGCGTTGACTACTTCAAATCCAAGGGCTTAGATGAACAGGATTACGCTACACTCCTAG
GA
GCGCACACGATGGGAAAAGCACACTGCTCATCGATTTACGACCGCCTCTACAACTGGGGAAACACGAAGAAACCAGATCCGAGCATGAGCAAGGCCTTATTGGAAAAACTGAGGAAACAA
TGTCCGAAAGTAGTGGTACCGAAGAAGGATCCGACAGTATTCTTAACCGAAAAAAACGGAGAACAGTACAGATTCACGAACAACTACTACTCCAACGTGCTGACTCAAGATTCGGTTCTT
AGGGCCGACCAAGAGTTACTGTATGGATACAATACATCGCAGTTGGTGCTAGAATACGCCGGCAGTTTCGAGCAGTTGAGGCGGCAGTTCTCATTGTCGATTAGCCGATTGGGCGGTCTC
AAAGTCTTGACCGGTACCGATGGGGAGATTCGCGAGAGCTGTCGTTTCAGAAACGCCACTGAAATACTACACTAA

Retrieve as FASTA