Entry information : MguPrx90 (mgv1a022544m)
Entry ID 9248
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2012-01-03 (Qiang Li)
Sequence status partial
Reviewer Not yet reviewed
Last annotation changes 2012-01-03 (Qiang Li)
Peroxidase information: MguPrx90 (mgv1a022544m)
Name (synonym) MguPrx90 (mgv1a022544m)
Class Class III peroxidase     [Orthogroup: Prx017]*
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx90
start..stop
S start..stop
MguPrx[P]110 314 3e-109 186..340 1..155
MguPrx74 288 6e-97 70..323 34..304
MguPrx[P]111 272 9e-93 1..185 1..163
GhPrx35 276 4e-92 63..323 50..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 59330..59593 264 N° 2 59666..59701 36 N° 3 59757..59852 96 N° 4 59997..60155 159
N° 5 68245..68316 72 N° 6 68410..68643 234  
join(59330..59593,59666..59701,59757..59852,59997..60155,68245..68316,68410..686 43)


exon

Literature and cross-references MguPrx90 (mgv1a022544m)
DNA ref. Phytozome 12:   scaffold_98 (59330..68643)
Protein sequence: MguPrx90 (mgv1a022544m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340
PWM (Da):   %s   37392.16 Transmb domain:   %s   i2-24o
PI (pH):   %s   7.15
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ILLIFLSSVLFFCFSYIYIYIIHLRSHLINDEQSSSIRATRSTIHVHNTRFVPERRGHCQPSVNRAAIDNPRVPLILLRLYFHDCFVEGCDGSILLIQRADGECQTSIRICLPDVVSCADIVAMTARDAIVLVGGPIYAVKTGRRDGTVTSRLLATDMPDSRDPVDILKSKFFSKRLSEAELVIDVGGAHTIGTTACFFVTDRLYTFGGGVNASDPVISPDLLPSFQSQCPRGGDILARTPLDHVTSSVFDDQSLRNIRSGFSVLPSDAILYSDRVTRSVVDTYVVDDSTFARDFAIAMVKMGRIGVKIGNGSEIRRVCDAANQGQLIITPGAYYNYFFL

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTTTATTAATTTTCTTGAGCAGTGTTTTATTTTTTTGCTTTTCNNNNNNNNNNNNNNNNNNNNNNCATCTTAGGTCTCACTTAATCAACGACGAACAGTCTTCTTCTATTCGCGCTACT
CGTAGTACAATTCATGTTCACAACACGCGCTTCGTGCCCGAACGCCGAGGCCATTGTCAGCCAAGTGTGAACCGAGCTGCCATCGACAACCCTCGTGTGCCGCTGATTCTTCTCCGACTG
TATTTTCACGATTGCTTTGTCGAG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATTTCTGTTTTCTTTTCACTTTGAGGGTTGCGATGGTTCTATTTTGCTT
ATACAAAGGGCA
TAGACCAACCCAAGAAGGAAGCACTTGGCCATCAAGGAGTCCAATGATTTCTTGAGATGGCGAGTGCCAAACAAGCATTCGAATCTGCCTGCCCGACGTTGTTTCGTG
TGCGGACATCGTCGCTATGACCGCACGAGACGCCATCGTATTG
GTAATTTTTTTTTCTTTTTTTCTTTTTAGAAATTTCAATTGAAATATGTGGGGATGTGAACTGAATTGGTAGATAAT
TAGTTGTGGTAATTATTTTTCAATTGAAAGTAAATAAATATTTTTTTTCTTTTTTCTTTACCCCTAGACTGGTGGACCGATTTACGCAGTCAAGACCGGGAGAAGGGATGGCACGGTTAC
AAGTAGATTACTTGCAACCGACATGCCTGACTCTCGCGACCCAGTCGACATCCTTAAGTCCAAGTTCTTCAGCAAAAGACTTTCCGAGGCCGAGCTCGTCATTGAT
TGATTGAAAATGTT
GATTTTTATTCGAGACTTGAAAAAAGTATATTGTTCCTAGTGTGTGTTTATGCATTAAAATTTTGCATTTGTTGAGAAAATTCAATTTGTTATGGAAGTTTGAAAACAAGTAAATTATTA
TTACAATTTCAATTAATTTGAGTTTGTATCGATGAACCATAGAAACAAAGTCAATAAATTATGCAATTTCAAGATTATTTAGAAATTATCGCCTCTATAAAAAAGGATTGTTAGAAACTA
TACACATACTTTGCACGTACTTTGCACGCACTTTGCAGNNNNNNNNNNNNNNNNNNNNNNNNGAAGTCAGTTGTGTCCTCACTATCTCAACGAATCATTGGACTCCTTGATGAGATACAA
ATTATTAGAAGTTACCCTTCATTGGACCTTGTTATCTAGAATCTAATATTAAAATACATGTGAAGCGTTGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCCTTATATCTAATATTAAGTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTAAAAACCAAATCTTGTTTGTTGCTGGTAAGCTCAATCCTTATATTATTTTATTTGAAAGACGGCCTATCTGGCCCACGGACTCTGCCCACTCGGCCCATTTGTTTCATGGCC
GATGGCCCGGCCCATGTAGGAAAACCATGTCAAGCCCGACTCCTCAGCCCATTTTACCCTATTTTGACGGTCCCGAGGGGCCTAAGGCAAACATCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCATAAAA
GTAGAAACTTAATAAGAAAAGTTTAAAGTAGAAACTCATACTTATTAAAGTTGAAAGTTGCAGAATAAGTGGTACTGAAGATAAAATTACATAAGGAAAATTATAAGGAATTTTTTTTCA
AGCTGTTGGAAGAGCTACATGCTGTTAGTCACAGCTTTTTGAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTATAAAATTTGGGCC
AAAAACGGGTCAGGCCTTGCGGGCGGCACCCGGCCCGGACCAGCCCACGGAGTAAAAGTGATGCCCATCCCATGATATTAAATTTCTGGGTTGAATCCATGGGTTTGCTGTGGGCGGGCT
TCACTGGCCTGGGTTGCGGGCGGGCCGTGGGCCCATGGTGGATGCAAGGAGGACGAAAAAAGCATCCATGGTGGACGCAAAAGGGTGTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCTAACGATATTAAATATTCTTAATGTAAATGTTTTATGTGTTTTTTCTTTTGAAAGAAGTGAACGATGTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAAAATTCGATTAATTTAGAAAAACATTAAATTAGCGAATTAACAATT
TAATAATTTATTACTATATCGAAGTTCTACTGTATATATAGAAAATAAATGGTGTACTCGATTGAAATGTCCAATTAGTAGTCCTTAGAAGGCCGAAAATTTAAAAGGAAATAAAAACTC
AAAGATTGGCCCAATTCGGCTTTGAAAAGCCCAAAGCCCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCTAGGGCTTTTTCTCTCTGTAGAAGTTA
CAGTGAACCTCTAGAAGAAGCAGCTTCATTTTCAATGGCGATGCCACTGGGGAGGGACGATTACGCTGAAGACGAGCTGGATCAGGACGAAGATTACGAGTGCGACGCCGTTGATGAAGA
GACGGTGGTGGATAGCGACGGATAAGAGGAGGAGGACGACGACGGAGATGACGGTTAGGGTTTCGTTTATTCTTTCTCTCCGCCGGGAAATTTATTTTCTTCATTGATTCGTATTCTTCA
ATTGAATTTTGAGTAAAGTTGCACCTACTGTTACTGTCAAATGGAAAAAAACTGGAAGGCAAAATGCATGATTTTTGTTATTGTCATAACAAATTCAACGCTGGTTAATGATTTTTGTTT
GTTATTCAACATGATAGTGGAAATTATGAGGAGCTTCACATTGGGATTTACACTGTTACTAGGTGAATTTTCTGAATCAAAATATTTGGGGCTTAAATCGAAAAGATTTTAGGGTGTGAA
ATTTGAATTTAAATGGCAGAAGAAACCATTAATAACAGCTTAAAAATTCAGAGAAGTTGTTGGTTCAATTGACTGAAAAGGACATGTGTGGCGGAGTAAATGCTTGATATTTCGATTTTC
AAAACATGGCGAAGGTTGATAAATGCTCGTTGTCGTAAATGTTGGTGTGTGTTGTGTTGGGTTGAGTCTTGCAATTAGAGCATTATCCATGTTGGTGATCTTTTCCTATGTTGATTATAA
TTTATTAGAGTTAGGAATTGAGCAAAAGTCAGATTTAGATATTTTCATTAGTTAACTTTTGTTTATGCGAGTTCCGATTTAATAAACTTGATGTCACAGTGTTATCAACGCATGTCCTAT
TCGTATTATGTTATGTATTTTTGGATCATCATAATCTCTTACTAGGTAATTGAAATGATTGCAAATGCTTTATTCATGTTCATTCTGTTTTTTTATTATGCTGAGTAGATGGTCTCACTT
GTTCACAGTTGCTATTATCGTCTGTTAATCTGATGTTCTGGGATCTCGATATATAGCAGGCAATAGTCGTTGAACAGCAAGCTCTCTCTGCCGTCGATTAGGGTCTAAAATTATGGATGG
TGAAATGTGCGGTATGATAGACGAAATTCTTTAAATGGAGTTAGCAGTTTGCCCTATGCATAATTATATCGGTAAAGGGATCTGAGTTACCAACTAGATCCGTCGTAGCATTTGATCATC
TCAAAAGCTATATACATAGAGGCAGAAAAATCTATTTCAAATTTTATTTTTCTGTTTTTTTTTTTTTTTCACGTGTGAATTCTTGTAATAAAATTGATTATATGTGTAGGGAGGAACAGC
TTTGAGTGTAGATTAAACGTGTCGTGGGTGATGCTTTTCAGGTTAGCCCTAATAGATAGGAACGGACCAAGATTATTGTTTTGATGTTAGGAGATATTAAACACAAGATAGTTAGTTAAG
AAGTTGTTTTACGAAAGACCGACGTAAGAACATTTATCCATTTTAGATGTTGTAAAGATTCTAGAGGCGCGTCTCTGTAGGCTGCGCTTCTCGAACTGTACTTTTAGTTTATGAATATAA
TTGATCTTTTGGTTCGGTCCAATTTTGTTAACTTAACCCCGATGTTGTAAAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTTTCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAACTGATTTTTCAC
TTGAGTTCAAATTATACGGTTCGACCAACCGGACCGGGCTAGTCAACGGCGGTTTAATTGAGCCATCTGTACTGTAAATCTATAATAGCTGATAGAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCTTTTGTCGTACAACACAAAATCAAGCAAATAGACATAAAATAATTTCATGTAAAAATTATTTCAAGAAATGAATAATTCACAAACCAGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGCACTTTATTCGAACATTTTCTTCTAATGTTTTGGATACTTGTAAGTTGCAAGAATTCATTGAATGGACATGGGTTCAACTTCAAGTATGGAAAAAATCCATTT
TAATTATACATTATTAAGTGGTCCATCTGATTTCATTCTATTTCAAGATTTTGCGTATAACAGCCATCGTTCTTTGTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNATTATTATATTATT
TAATAGAATTGCTGAGGAAATATAGTTGTTTATCACACGTGACATTAAAATCCAATCTGATTACAATCATCGTGGGAATCTGAACCACACACAATAAATACATGGTAGACCTAAATTGAG
AAAAAAAACAGCATTATTAATTAGGGCTGACATTGATTTTCAATCATGTTTGCATGAACTCTTGATTTATTTTTGTAAATTTCACACGTACGGAGGGATGCCCATGCATGTTTGCATGGT
AAATTGCGCAAACAAACATAATTAACTTTACACGTGTAAACTTATATTTATTATTAAATTGAGCAATCTATATTCTATACTGTAATTGAGCAATGAAAGAAATATTATTGGACTATAATT
AATTGTGGATCTTTTTTAGTTCATATTTTTGGCCCAAGCAGTTTCGGTTGGGCCTTCTTAGGCCCTTTAAAGTTTTTAACAAGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAAATACCGTAAGGTGGATTGTAAT
TCACCCCCAAATAATAATAAAACAAAAAAGGTGACAGGTGGGGTGGGAAAGGTACTGCACATGCATGCATGTATAAAATTCACTGCACTACGTAGGATCGAAGTAATTCTTATTACCAAA
TAAGATATATAGATGATTATAGCAAATTTTTCTATATATAGTTCTTTTGTCGAATAACACAGAATCAAGCAAATAGACNNNNNNNNNNNNNNNNNNNNNNNATATGTTTTCATGTAACTA
TTATTTACAAGAAACGAATATTTCTCTAAATACCACTATTATCCTAATTATTGTTATTTTAAAGCAAATTATTCAAATATTTTTGGAAACTTTTGTATATATATAGTTCTTTTGTCCTAT
AACACAAAATCAAGCAAATGGACAAAATATAATTTCATGTAAAAAATATTTCTAGAAATTAATAATTCATAATTAAACCAGTATTTTAATCCTAATTAATGTTTTTTTAAAAGCAATTTA
TTCGAATATTTTCTTCTAATGCTTTGGATACTTGTAAGTTACAGTAAACTCATTAAATGAGCATGGGTTCAAGTATGGAAAACCCCATTTTAATTAATTATTAAGTGGTCCATCTGATTT
CATTCTATTTCAATATTTTGGATACTTTCTTTCTTTTTCTATTTTTGAGGGCTTGCATGCATGCACGTACTTAACACTTATGGTGAATTCATTCTATTTCAATACTTTGGATACTTTCTT
TCTTTTTCTATTTTTGAGGGAATGCATGCATGCACGTACTTAATCCTTATGGTGAATTCATTCTATTTTAAGGTTTTGCGTATGCGTATAACAGCCACCTTTTCCTTTTTTTCACGTGTA
AACTTACATTTTTTTTATTAAAAAAAGTGTAAAATAAACGCCAATTCATCAAATTAACAACTATATATAGATATGCATGTTATGTCTTATTCTTCCCTCACTGCTTCATCAAAGTTCATA
ACTTTAATTTCTTTCACCTAATTCCTCAAATTAAATGGATCCAAAAGCAATTTTTTTTGTCATAATTATTTTTCACCACCATTTTATTTCAGTAGGAAGCGAACTTCAAGTTGGCTTCTA
CTCCGACAAGTGTCCATTCGCGGAGGCGACCGTCGAGGCTGCTGTGGTGGACGCTGCGGTAGTCAACCCTAGGGTTGCCCCGATTCTGCTCCGCCTTCATTTCCACGACTGCTTCGTGGA
GGTGTAATATAATTCCTATCTTACCNNNNNNNNNNNNNNNNNNNNNAATTATTTGTATGTTTTAACCTTTTATTGTTTCTGTAGGGCTGTGATGGATCCATACTGATTACAACCGGCGTA
CAGGATGCTGAAATTAGTGCATCCGCACACCAAGGGGTAATGGGGTTCGACGTGATCGCGAAAGCGAAAGCGGCAATCGAAGCTCAGTGCCCGGGGGTCGTGTCGTGCGCTGATATCGTG
GCGATTGCCGCTAGGGATGCCGTCGCCTTGGTACGTACACGAATCGTTTTAGTTTTGAAGTGTTTAATTTATTTATGTATAATTTTCTAGCAAAACTTAATCGGAAAATATCACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNATTGGGATACCAATAAGACCAATATATAGTATGTTATACTATATTGATACTAAATAAAATATTACTTTTATATTCACTAAGATATTTTTTAAGAAAATATGGATTAT
TTTACATTATAAGAAATTAGTATTTTTCATTAAATCTGTTACAGTTATAATTTTTAAGAAAAACTGGACCTTTTTATGGGCCTATTTCATATATTTAAAATATGTGAAACTAAACTGGCC
TATTTCATATATTAAACTGGCCTAACTTGGTTTTTATAATTCAAGTGGATACAATCATACAACCGTAAAAAAATAGCCTAAACTTGGTTTTTATATTTACTCAAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTCAAAATTTTATATGATGTAAACTTGCATACCAAAAAGACTAATATATAGTATATTACACTATATTGATGCTAAATATAATATTATTA
CTTTTAAATTCACTAAGATATTTTTTAAGAAAATATGGATTATTTTACACTATAAGAAATTAGTATTTTTCATTAAATCTGCTACAATTATAATTTTTAAGAAAAACTGGACCTGTTTAT
GGGCCTATTTAATATATTAAACTGGCCTAACTTGTTACTCAAAGTCAGCCCAGCCCACTTAATTATGGGCCTATGTCATATATTAAAAATCGGCCGAACTTCTTACAGCCCAGTTTCAGT
CCAAGTCCAACTTAACTCTAATAAAACGTCGCCCTTTGCTTAATCGATGTTTGTGTTTTAATTTATTTGTCTTTTGGCTGATTTTTTTGTTTTTCTCTTTTGGCAACACGTGTTAAGGCC
GGAGGTCCGACTTATGAGGTCGAGACCGGTAGAAGAGACGGTAGGCTTTCCAGTGCAAATATGGCATGGCGCATGCCACAATTTCACGATTCCGTCCACACGCTTCGGTTAAAGTTCTTC
GAGAAAGGACTCACCGAAGCCGATCTCGTCTTGCTAAGTGGTAAGTAGTCNNNNNNNNNNNNNNNNNNNNNNNNNCATATTAGCTTAGTTTATTCGAGTCACTTTTCAATAAAATCTAAA
ATAACGGNNNNNNNNNNNNNNNNNNNNNNNNNNCATCAGGGGGAGCACATACGATCGGTACTACAGCCTGTTTTTTCGTCAGAGACAGGCTGTACGCCTTCATGGGTACAAATACATCCG
ATCCAACAATTAGCCCCGCTCTGCTACCTTCACTAGAGCGCCAGTGCCCAAAGGACGGAAGTCCAATGGATCGACTACTTCTCGATCAAGTGACTGGAGAAAGATTCGACGTCCAGAGCT
TGATCAACATTAAGAATGGGCTCTCCGTCCTGCCCTCAGATTCCATACTGTACGACAACAACATCACCAAATCCGTTGTCGATTTCTACAGTGTCGACAAATCCTCATTTGCAGAGGATT
TTGCGGTGGCTATGATCAAAATGGGTAGAATCGACGTCAATACGGGAACCGAGGGAGAAATACGGCAAGTCTGC

Retrieve as FASTA