Entry information : MguPrx92 ( mgv1a023088m)
Entry ID 9250
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-12-08 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-28 (Christophe Dunand)
Peroxidase information: MguPrx92 ( mgv1a023088m)
Name (synonym) MguPrx92 ( mgv1a023088m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx92
start..stop
S start..stop
PpePrx26 519 0 2..319 7..321
CroPrx57 515 0 20..319 30..329
VvPrx47 513 0 20..319 25..324
RcPrx09 509 0 4..319 6..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 225817..226011 195 N° 2 225534..225713 180 N° 3 225265..225427 163 N° 4 224259..224680 422
complement(join(224259..224680,225265..225427,225534..225713,225817..226011))


exon

Literature and cross-references MguPrx92 ( mgv1a023088m)
DNA ref. Phytozome 12:   scaffold_63 (226011..224259)
Protein sequence: MguPrx92 ( mgv1a023088m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (304)
PWM (Da):   %s   34357.45 (32748.5)  
PI (pH):   %s   7.72 (7.72) Peptide Signal:   %s   cut: 16 range:16-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLILITNVIIFPALGQIVSLKTGFYSSSCPKAESIVRSTVESHFNQDSTLAAALLRLHFHDCFVQGCDASVLIDTPSSERKAVPNLGLRGFQVIDDAKSQLEALCPGVVSCADILALAARDSVDLSGGPSWGVGTGRRDGRISLSSEASNLPSPFDSVAIQQQKFAAKGLDDHDLVTLVGAHSIGQTDCLFMRYRLYNFTASGTADPTISQSFLGTLQSLCSKDGDGSKRVALDKDSQFKFDSSFFKNLRNGNGILESDQRLWGDSSTRRIVDNYAGSIRGLLGFRFNFEFPKAMIKMSSIEVKSGAQGEIRKVCSKIN

Retrieve as FASTA  
Remarks Complete sequence from genomic '3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGATTCTTATCACTAATGTAATAATATTTCCAGCCTTAGGTCAAATAGTGTCACTAAAAACAGGCTTCTACTCTTCTTCGTGTCCTAAAGCGGAGTCGATAGTTCGATCGACAGTC
GAATCCCATTTCAACCAAGACTCCACCTTGGCTGCCGCTTTGCTCAGGCTCCATTTTCACGATTGTTTCGTTCAA
GTAAATATTTATATATAACTCTTTCTTGAATATCAATTTTTTTTT
GTAGCTAATGATTTTAATTTTCAGTGAGTAATACTCTTTATCTACGTTGTGCACACAGGGGTGTGACGCTTCGGTTTTGATCGACACTCCTTCTTCGGAAAGAAAGGCGGTGCCTAATTT
AGGGTTGAGAGGATTTCAAGTGATTGATGATGCTAAATCGCAGCTCGAGGCCTTGTGTCCAGGTGTCGTCTCGTGTGCCGATATATTAGCGTTGGCTGCTCGTGATTCTGTCGATTTG
GT
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATAGAGTTTGTCGTAATTTTTTTTTGTATGACACGATATATATATATGCAGAGTGGCGGCCCGAGTT
GGGGAGTGGGTACGGGAAGAAGAGACGGAAGAATATCTTTGTCTTCGGAAGCTTCCAATTTGCCGAGCCCTTTCGATTCCGTAGCTATTCAGCAACAGAAATTTGCAGCCAAAGGCCTTG
ATGACCATGATCTTGTCACACTTGTTG
GTAATAAATTGAAACTTCAAACTTTTTAAAAGAGATACTCGTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCCTACTTATGTTATACACACACACACACGTATATACACACATGTGTATGACAACTTACATGTATATTA
TGATCATATAGGAGCACACAGCATAGGGCAAACAGATTGCCTTTTCATGCGATATCGACTCTACAACTTCACGGCAAGTGGGACCGCTGATCCGACTATAAGCCAATCATTCTTAGGTAC
ATTACAATCTCTTTGTTCAAAAGATGGAGACGGTTCGAAAAGGGTGGCGTTGGATAAAGACAGCCAGTTCAAATTCGACTCGAGTTTCTTCAAGAATCTGAGGAACGGTAACGGCATTCT
TGAATCGGACCAAAGGCTTTGGGGTGACTCATCAACGCGTAGAATTGTCGATAATTACGCGGGGAGTATAAGAGGTTTGCTTGGTTTTAGGTTTAATTTCGAGTTCCCGAAAGCTATGAT
TAAAATGAGTAGCATTGAGGTAAAGAGTGGTGCACAAGGGGAGATTAGAAAGGTTTGTTCAAAAATCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGATTCTTATCACTAATGTAATAATATTTCCAGCCTTAGGTCAAATAGTGTCACTAAAAACAGGCTTCTACTCTTCTTCGTGTCCTAAAGCGGAGTCGATAGTTCGATCGACAGTC
GAATCCCATTTCAACCAAGACTCCACCTTGGCTGCCGCTTTGCTCAGGCTCCATTTTCACGATTGTTTCGTTCAA
GGGTGTGACGCTTCGGTTTTGATCGACACTCCTTCTTCGGAAAGA
AAGGCGGTGCCTAATTTAGGGTTGAGAGGATTTCAAGTGATTGATGATGCTAAATCGCAGCTCGAGGCCTTGTGTCCAGGTGTCGTCTCGTGTGCCGATATATTAGCGTTGGCTGCTCGT
GATTCTGTCGATTTG
AGTGGCGGCCCGAGTTGGGGAGTGGGTACGGGAAGAAGAGACGGAAGAATATCTTTGTCTTCGGAAGCTTCCAATTTGCCGAGCCCTTTCGATTCCGTAGCTATT
CAGCAACAGAAATTTGCAGCCAAAGGCCTTGATGACCATGATCTTGTCACACTTGTTG
GAGCACACAGCATAGGGCAAACAGATTGCCTTTTCATGCGATATCGACTCTACAACTTCACG
GCAAGTGGGACCGCTGATCCGACTATAAGCCAATCATTCTTAGGTACATTACAATCTCTTTGTTCAAAAGATGGAGACGGTTCGAAAAGGGTGGCGTTGGATAAAGACAGCCAGTTCAAA
TTCGACTCGAGTTTCTTCAAGAATCTGAGGAACGGTAACGGCATTCTTGAATCGGACCAAAGGCTTTGGGGTGACTCATCAACGCGTAGAATTGTCGATAATTACGCGGGGAGTATAAGA
GGTTTGCTTGGTTTTAGGTTTAATTTCGAGTTCCCGAAAGCTATGATTAAAATGAGTAGCATTGAGGTAAAGAGTGGTGCACAAGGGGAGATTAGAAAGGTTTGTTCAAAAATCAATTGA

Retrieve as FASTA