Entry information : MguPrx96 (mgv1a024365m)
Entry ID 9254
Creation 2011-07-02 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: MguPrx96 (mgv1a024365m)
Name (synonym) MguPrx96 (mgv1a024365m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Phrymaceae Mimulus
Organism Mimulus guttatus    [TaxId: 4155 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MguPrx96
start..stop
S start..stop
CroPrx12 477 4e-171 1..337 1..330
CpapPrx45 464 6e-166 1..337 1..342
PtPrx70 459 9e-164 42..337 43..337
NtPrx36-1A 451 8e-161 7..337 8..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 864704..864946 243 N° 2 864416..864607 192 N° 3 864153..864318 166 N° 4 863330..863742 413
complement(join(863330..863742,864153..864318,864416..864607,864704..864946))


exon

Literature and cross-references MguPrx96 (mgv1a024365m)
DNA ref. Phytozome 12:   scaffold_18 (864946..863330)
Protein sequence: MguPrx96 (mgv1a024365m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   338 (316)
PWM (Da):   %s   36848.51 (34280.3)  
PI (pH):   %s   7.66 (7.66) Peptide Signal:   %s   cut: 22 range:22-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDHKTFYLAVFLCMVFHSVNALPLRTHYEKPDDDPLNCNFYDKSCPNLSMIVRWGVLSAFKNDTRIGASLLRMHFHDCFVDGCEGSILLDDTKSFKGEKNAVPNRNSVRGYDVIENIKAEVEKSCPSIVSCVDILALAAREAVVLSGGPFWEVPLGRLDGLTASAKSANEQLPSPFEPLENITSKFVSKGLDLKDVVVLSGAHTIGFAQCFTFKRRLFNFKGSGKPDPTLDSSVLSSLRNSCPNTDKSNTKLAPLDSQTINSFDNMYYKNLVNNTGLLESDQALVGDPKTASMVKDYSVDPNLFARDFAASMVKISRIGVISSGGGGQVRKKCSSVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCACAAAACCTTTTATCTTGCAGTTTTTCTGTGCATGGTCTTCCATTCGGTCAATGCTCTACCTCTCCGTACTCATTACGAAAAACCCGACGACGATCCACTAAATTGCAATTTC
TACGATAAGTCTTGTCCTAATTTGTCGATGATAGTGAGGTGGGGTGTTTTGTCAGCGTTCAAGAACGACACCCGAATCGGAGCTTCGCTCCTTCGCATGCACTTCCACGACTGTTTCGTA
GAC
GTAATAACTACTCAATTCTTGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGTATATGTATAGGGCTGTGAAGGTTCTATACTT
CTTGATGACACAAAAAGCTTCAAGGGAGAGAAGAACGCTGTGCCTAACCGTAATTCGGTTAGAGGGTACGATGTAATCGAAAACATAAAGGCGGAGGTTGAGAAATCTTGCCCCTCGATT
GTGTCGTGTGTCGACATATTAGCCCTTGCTGCTAGAGAAGCTGTTGTTCTT
GTATGATAAATTCTTTTATGTGTTAATTACTTCATTAATTATATTGTATACTCTAGGGAGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGTAGTCAGGAGGGCCATTTTGGGAAGTTCCACTAGGAAGATTGGATGGGCTAACAGCAAGTGCAAAATCAGCAAATGAACAATTGCCTTCACCATT
TGAACCTCTTGAAAATATCACTTCTAAATTTGTCTCAAAGGGTCTTGATCTCAAGGATGTGGTTGTCTTATCAG
GTATTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACACGTGTATTTATT
GCAGGTGCACACACTATAGGTTTTGCTCAATGCTTCACATTCAAGAGGAGGCTATTCAACTTCAAAGGGTCGGGCAAACCGGACCCAACTCTCGATTCTTCGGTCCTCTCGAGTTTGCGG
AATTCTTGTCCGAATACCGATAAATCGAACACAAAACTTGCTCCGTTGGATTCGCAGACGATAAACAGTTTTGATAATATGTATTACAAGAACCTAGTTAACAACACAGGACTTCTCGAA
TCGGACCAGGCTTTGGTCGGAGATCCGAAAACAGCTTCGATGGTTAAGGATTATAGCGTCGATCCGAATTTATTCGCACGAGATTTCGCAGCTTCGATGGTGAAGATTAGTAGAATTGGA
GTGATTAGTAGTGGTGGTGGTGGACAAGTTAGAAAGAAGTGTAGCTCTGTGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCACAAAACCTTTTATCTTGCAGTTTTTCTGTGCATGGTCTTCCATTCGGTCAATGCTCTACCTCTCCGTACTCATTACGAAAAACCCGACGACGATCCACTAAATTGCAATTTC
TACGATAAGTCTTGTCCTAATTTGTCGATGATAGTGAGGTGGGGTGTTTTGTCAGCGTTCAAGAACGACACCCGAATCGGAGCTTCGCTCCTTCGCATGCACTTCCACGACTGTTTCGTA
GAC
GGCTGTGAAGGTTCTATACTTCTTGATGACACAAAAAGCTTCAAGGGAGAGAAGAACGCTGTGCCTAACCGTAATTCGGTTAGAGGGTACGATGTAATCGAAAACATAAAGGCGGAG
GTTGAGAAATCTTGCCCCTCGATTGTGTCGTGTGTCGACATATTAGCCCTTGCTGCTAGAGAAGCTGTTGTTCTT
TCAGGAGGGCCATTTTGGGAAGTTCCACTAGGAAGATTGGATGGG
CTAACAGCAAGTGCAAAATCAGCAAATGAACAATTGCCTTCACCATTTGAACCTCTTGAAAATATCACTTCTAAATTTGTCTCAAAGGGTCTTGATCTCAAGGATGTGGTTGTCTTATCA
G
GTGCACACACTATAGGTTTTGCTCAATGCTTCACATTCAAGAGGAGGCTATTCAACTTCAAAGGGTCGGGCAAACCGGACCCAACTCTCGATTCTTCGGTCCTCTCGAGTTTGCGGAAT
TCTTGTCCGAATACCGATAAATCGAACACAAAACTTGCTCCGTTGGATTCGCAGACGATAAACAGTTTTGATAATATGTATTACAAGAACCTAGTTAACAACACAGGACTTCTCGAATCG
GACCAGGCTTTGGTCGGAGATCCGAAAACAGCTTCGATGGTTAAGGATTATAGCGTCGATCCGAATTTATTCGCACGAGATTTCGCAGCTTCGATGGTGAAGATTAGTAGAATTGGAGTG
ATTAGTAGTGGTGGTGGTGGACAAGTTAGAAAGAAGTGTAGCTCTGTGAATTAG

Retrieve as FASTA