Entry information : PpeAPx02 (ppa009582m)
Entry ID 9261
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpeAPx02 (ppa009582m)
Name (synonym) PpeAPx02 (ppa009582m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpeAPx02
start..stop
S start..stop
MdAPx02 523 0 5..284 6..285
NtAPx05-1A 475 9e-172 1..286 1..286
GhAPx01 474 1e-171 1..286 1..287
LeAPx05 473 5e-171 1..286 1..286
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17685704..17685816 113 N° 2 17685259..17685383 125 N° 3 17684899..17684948 50 N° 4 17684395..17684460 66
N° 5 17684258..17684306 49 N° 6 17684014..17684096 83 N° 7 17683847..17683926 80 N° 8 17683632..17683734 103
N° 9 17683336..17683527 192  
complement(join(17683336..17683527,17683632..17683734,17683847..17683926,1768401 4..17684096,17684258..17684306,17684395..17684460,17684899..17684948,17685259..1 7685383,17685704..17685816))


exon

Literature and cross-references PpeAPx02 (ppa009582m)
DNA ref. Phytozome 11:   scaffold_7 (17685816..17683336)
Protein sequence: PpeAPx02 (ppa009582m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   286
PWM (Da):   %s   31347.2 Transmb domain:   %s   o258-280i
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEPVVDAQYLKEVEKARRDLRALISVRNCAPIMVRLAWHDAGTYNAETKTGGANGSIRNEHELNHGANSGLKIAVNFEEVKAKYQKITYADLYLAGVVAVEVTGGPTIEFVPGRKDSLESPEEGRLPDAKQGASHLKDIFYRMGLSDKDIVALSGAHTGRAHPERSGFDGPWTNEPLKFDNSYFVELLKGESEGLLKLRTDKALLDDPEFRRYVELYADEDAFFKDYAVSHKKLSELGFAPSSSVKEAVKTSTLVAQSAVGVAVAAAVVILSYLYEVRKKV*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAACCAGTAGTGGACGCGCAGTACCTCAAGGAAGTCGAGAAGGCTCGTCGGGACCTTCGCGCTCTCATCTCCGTCAGGAACTGCGCTCCTATCATGGTTCGATTGGCGTAAGTG
CTCTCTTTTCACTTTCGTCTTTACTGTTTCCACGTTCCGTTTGGCTTCCGAGAAAAACTAGGAGAAGGAAGGGGAAATGAAATTTATATCTAGTGTCTAGTTTTATTTTTGAGTAAGGAT
GAGTTTACTGTTTAGGTTTTTAGTTTCTTTTTTTCTTTCTTGCATTTTCCGTTTGACCAAACAGCTCATTAGTCTGTTACTGTTCGATCAACAAAGTCAATGAATAAAAGAAGAAGAAAG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTACTAATCAGAAGTCACTTTCAATCAATTGAGGCAGGTGGCATGATGCTGGGACATACAATGCTGAAACGAAAACCGGTGGCG
CTAATGGCTCCATCAGGAATGAGCATGAGCTAAACCATGGCGCAAATAGTGGTTTGAAAATTGCTGTTAATTTTTGTG
GTGAGAATTTTTGGGAACTTTTATCTGTACTGAAGTTCTTAA
GCAATTCATTGATAGTTTATACTGATAATTTTCATATTAAAAAAGCAAAAAATTTGTACTGATTTTGATGAGGTCAACTCATATGCAGAGCTTATCTATTGGGTTCTATTGTTTTTGCAG
TATCCTAGAGTTAATTCCAATTCTGAGTTGTTGTACTCTTTGAAATGACTGAAATTGGAAACCATTCGGTCTCCCAAGAAATTTAATTGTAGATGCCAAACAGTTGAATTTTCCCCTAAT
TCTTTTTGTTGTTCTGTTTTGATAACAGAGGAAGTGAAAGCCAAGTATCAGAAGATCACATATGCCGACCTCTACCAGGTGGCTGTAGTTTTATAATCTCTCATTGTTTTGTTGTGAACC
TTTGGCTTTATGTTGTACTTGTTGTTTGGTCCTTGATATATGCTATTTCATAAGGAAAATGTTTGTGTAACATAATACACTGCAAAGCTCAATGGACTCTGGTAGATTTCAAGGGCCATT
GTTTTATGAATTATGGTTCCGATGTGTGATTTTTTGGGGAGGATCTCATCTTTATGGAAACTTTCTATCTCATCTACCAATGTAGGTCTAGTTTTTATTTATTTATTTTGTTTTATGAAT
GGAGCAAGTTTTATTTTGATCAGATAAAAAACGTCACACACATTCAATAGTTAGGGGCTTTTATTTTTTTCTGTAAATATTGGATGAGCTAGTTACCTAGCTCCATGTGAGAACCAGATT
TGAGTAACTCGTAATTTTACTGTCTTATGATCTTAGCTTGCTGGGGTTGTTGCTGTGGAGGTCACTGGTGGCCCTACTATTGAGTTTGTTCCTGGTAGAAAGGTATGTTCCTTCATGGCA
GTTGTTAATAACATATTTATCAAGTATGTTCCTTGCAGTTGTTCAACTTTCTTTCTATCTCTGAATCCAGGATTCACTGGAGTCTCCGGAAGAAGGACGGCTTCCAGATGCCAAACAAGG
TATGCATGCCTATAAAGTTTCAGCTGCTTTAATACAGAAACTTAGGTTCTGTCTCTTCTTCTTGGGTTATTTTTTATTAGTGTGCTAAAGGAAGATGAACAAATCATTATTCTGATTTCC
TTCAATGTTGTAATGGTTTGTTTTTTCGATTTTGCTGCAGGTGCATCACATTTGAAGGACATCTTTTATCGCATGGGTCTGTCTGATAAAGACATTGTGGCATTGTCAGGAGCCCACACA
TTG
GTAGCTTTTTAATGGACTCAACAATGTGCAAAATACTTTTCAGTTATATAAAATATACATATATTGAATACTTCTTTGTTTCTGTAGGGTAGAGCACATCCAGAAAGGTCAGGCTTT
GATGGCCCTTGGACGAATGAGCCTTTGAAGTTCGACAATTCATACTTTGT
GTAAGAAATCAATATTATACTTAACACAATTGATTTTTAAAACTTTCAATTGGTAGGACCAAATGCAGCA
CACATTGACAATTGTTTTATGTTGTAATTAAATTTTTATCAGTGAGCTACTGAAGGGGGAATCAGAGGGGCTGTTGAAACTTCGCACAGACAAGGCTTTATTGGACGATCCTGAGTTCCG
CCGCTATGTTGAGCTTTATGCAAAG
GTAACTAATTTGATTTATCTTCGGTAAATCAGTAAATAAATTGCAAGGAAATTAAGAGCTTGGGTGAAATCAAGGCTTTACCTTTTGGCTCTATT
ACCTTGCAGGATGAGGATGCATTCTTCAAAGACTACGCAGTGTCACACAAGAAACTATCAGAGCTAGGCTTTGCTCCATCGTCTAGTGTCAAGGAAGCTGTAAAGACAAGTACTTTGGTG
GCACAAAGTGCTGTGGGAGTTGCCGTTGCTGCAGCTGTTGTGATCCTGAGTTACTTATACGAAGTTCGTAAAAAAGTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAACCAGTAGTGGACGCGCAGTACCTCAAGGAAGTCGAGAAGGCTCGTCGGGACCTTCGCGCTCTCATCTCCGTCAGGAACTGCGCTCCTATCATGGTTCGATTGGCGTGGCAT
GATGCTGGGACATACAATGCTGAAACGAAAACCGGTGGCGCTAATGGCTCCATCAGGAATGAGCATGAGCTAAACCATGGCGCAAATAGTGGTTTGAAAATTGCTGTTAATTTTTGTG
AG
GAAGTGAAAGCCAAGTATCAGAAGATCACATATGCCGACCTCTACCAG
CTTGCTGGGGTTGTTGCTGTGGAGGTCACTGGTGGCCCTACTATTGAGTTTGTTCCTGGTAGAAAGGATTCA
CTGGAGTCTCCGGAAGAAGGACGGCTTCCAGATGCCAAACAAG
GTGCATCACATTTGAAGGACATCTTTTATCGCATGGGTCTGTCTGATAAAGACATTGTGGCATTGTCAGGAGCCCAC
ACATTG
GGTAGAGCACATCCAGAAAGGTCAGGCTTTGATGGCCCTTGGACGAATGAGCCTTTGAAGTTCGACAATTCATACTTTGTTGAGCTACTGAAGGGGGAATCAGAGGGGCTGTTG
AAACTTCGCACAGACAAGGCTTTATTGGACGATCCTGAGTTCCGCCGCTATGTTGAGCTTTATGCAAAG
GATGAGGATGCATTCTTCAAAGACTACGCAGTGTCACACAAGAAACTATCA
GAGCTAGGCTTTGCTCCATCGTCTAGTGTCAAGGAAGCTGTAAAGACAAGTACTTTGGTGGCACAAAGTGCTGTGGGAGTTGCCGTTGCTGCAGCTGTTGTGATCCTGAGTTACTTATAC
GAAGTTCGTAAAAAAGTCTAG

Retrieve as FASTA