Entry information : PpePrx15 (ppa008540m)
Entry ID 9267
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx15 (ppa008540m)
Name (synonym) PpePrx15 (ppa008540m)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx15
start..stop
S start..stop
PtPrx27 536 0 1..327 1..327
MePrx24 530 0 1..327 1..326
QrobPrx01 529 0 1..319 1..318
MePrx25 523 0 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16732587..16732799 213 N° 2 16732908..16733099 192 N° 3 16733208..16733370 163 N° 4 16734166..16734581 416
join(16732587..16732799,16732908..16733099,16733208..16733370,16734166..16734581 )


exon

Literature and cross-references PpePrx15 (ppa008540m)
DNA ref. Phytozome 12:   scaffold_3 (16732587..16734581)
Protein sequence: PpePrx15 (ppa008540m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (303)
PWM (Da):   %s   35388.01 (32836.7)  
PI (pH):   %s   8.32 (8.39) Peptide Signal:   %s   cut: 25 range:25-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSVRFSGILLASCFLVILGLSEAQLQLGFYAKNCPKAEKIVKDFVDEHIHNAPSVAAALIRMHFHDCFVRGCDASVLLNSTSSNQAEKVAPPNLTLRGFNFIDRIKTLLEAECPGVVSCADAIALAARDSIVATGGPFWKVPTGRRDGVISRRAEALANIPAPTSNFTTLQTSFGNLGLDLMDLVLLSGAHTIGISHCSSFSNRLYNFTGVGDQDPALDKQYAANLKANKCKSSTDNTTIVEMDPGSHRTFDLSYYTLLLKRRGLFQSDAALTTSSTTLNYINQLLKGPLQNFYDEFAKSMEKMGRVNVKTGSAGEIRKQCAVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATCGGTTCGTTTTTCCGGGATTTTATTAGCTTCATGCTTTTTGGTGATTTTAGGCCTCAGTGAAGCTCAGTTGCAGTTGGGTTTTTATGCCAAGAACTGCCCAAAAGCAGAGAAG
ATTGTGAAGGATTTTGTAGATGAACACATACACAATGCACCTTCAGTTGCAGCAGCCCTCATAAGAATGCACTTCCATGACTGCTTTGTCAGG
GTTTGTGTTCATCATCTTCTGGGCCCA
AGATTCTGCAGTCTACTTTGTTAGTGTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTGCTTGACAGGGTTGTGATGCATCTGTTCTTCTGAACTCAACTTCAAGT
AACCAAGCTGAAAAAGTTGCCCCTCCAAATCTAACACTCAGAGGCTTTAACTTCATTGACAGAATCAAGACCCTACTTGAAGCTGAATGCCCTGGAGTAGTTTCTTGTGCAGATGCTATT
GCTTTGGCAGCAAGAGACTCTATTGTAGCAACA
GTAAGATCTCCAACCAATCATCCAAGTTTTAAAAGTAAATTTTATTAAAACTGAATGAACTTATTATGTTTTTTTTTTTCTTTAAAT
CTTTTTCCTTGGTTTGGTTAGGGAGGTCCATTTTGGAAGGTTCCAACAGGTAGAAGAGATGGGGTGATCTCAAGGAGAGCAGAAGCCTTAGCCAACATCCCAGCCCCAACTAGCAACTTC
ACCACTCTCCAAACCAGTTTTGGTAATCTTGGTCTTGATTTGATGGACTTGGTCTTGCTCTCAG
GTAAATCTAAACGTTGAATAGGAAATGTTGCCTTTCCAAATAACCTACATGTTATG
TTGGTAAATTGTCAATTTGAAATATTGATTAAGTGCCCTCATATATATCGTATATATAAATATATAGAGCCAAATTGCTAATATGACGGCCTACTACTATGTAATATTCTCTTAAGAGAC
TTATGTTGTTTCTATGTTGACAAACTATTAATTTGAACTACTAATCGAGTAAACTCNNNNNNNNNNNNNNNNNNNNNNNNNCAGTCCCCTTCTATTGAGGGATCCCTCAAATAATTTTAT
TTGAGGGACGCCCTTTAGAGTACCCTACAATTCTTTTCTCAATAATCCAAACCATCTATTTTTTAGGTATTCATTCATAGATCATCCTTACAAAAAATTAGACAAATCGGAAACCGTTTC
GACATCCAATTGTGTCTTACAAAATCAATGAACACGGTGCTTTAAGAAAAGTACTAAAATTTCAATAACTCAATTGAGTGGTCACATGATATCGGATTCAAGTGATTTTTTGTAGAGATG
ATCTTTGAATGAGTATCTACAAAATAGACGGTTTGGATTAGTGAAATACAATCCGTAGTGGGGCCTACAAGAGGTGTCCCTCAAATAAACTTATTTGAGGGATCCCTCAATGGAAGCTCT
CTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTATTGAGTAATATTCTTTTACGAGACTTATGTTATTGAGTAATATTCTTTTACGAGACTTATCTTAT
CGCAAAATTGTGAATGCAGGGGCTCACACAATTGGTATCTCTCATTGCTCATCATTTTCGAACCGTCTTTACAATTTCACCGGAGTGGGTGACCAGGACCCGGCTTTGGACAAGCAATAC
GCAGCGAATCTCAAGGCAAACAAGTGCAAAAGTTCAACTGATAATACTACAATAGTTGAAATGGACCCTGGAAGCCACAGGACATTTGACCTCAGCTACTACACACTTTTGCTCAAAAGA
CGAGGCCTCTTTCAATCTGATGCTGCTTTAACCACAAGCTCAACCACCCTTAATTATATCAACCAGCTCCTCAAAGGTCCACTTCAGAATTTCTATGACGAATTTGCCAAGTCCATGGAG
AAAATGGGTCGGGTTAATGTTAAGACTGGATCAGCTGGTGAGATTAGGAAGCAATGTGCAGTTGTGAATAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGATCGGTTCGTTTTTCCGGGATTTTATTAGCTTCATGCTTTTTGGTGATTTTAGGCCTCAGTGAAGCTCAGTTGCAGTTGGGTTTTTATGCCAAGAACTGCCCAAAAGCAGAGAAG
ATTGTGAAGGATTTTGTAGATGAACACATACACAATGCACCTTCAGTTGCAGCAGCCCTCATAAGAATGCACTTCCATGACTGCTTTGTCAGG
GGTTGTGATGCATCTGTTCTTCTGAAC
TCAACTTCAAGTAACCAAGCTGAAAAAGTTGCCCCTCCAAATCTAACACTCAGAGGCTTTAACTTCATTGACAGAATCAAGACCCTACTTGAAGCTGAATGCCCTGGAGTAGTTTCTTGT
GCAGATGCTATTGCTTTGGCAGCAAGAGACTCTATTGTAGCAACA
GGAGGTCCATTTTGGAAGGTTCCAACAGGTAGAAGAGATGGGGTGATCTCAAGGAGAGCAGAAGCCTTAGCCAAC
ATCCCAGCCCCAACTAGCAACTTCACCACTCTCCAAACCAGTTTTGGTAATCTTGGTCTTGATTTGATGGACTTGGTCTTGCTCTCAG
GGGCTCACACAATTGGTATCTCTCATTGCTCA
TCATTTTCGAACCGTCTTTACAATTTCACCGGAGTGGGTGACCAGGACCCGGCTTTGGACAAGCAATACGCAGCGAATCTCAAGGCAAACAAGTGCAAAAGTTCAACTGATAATACTACA
ATAGTTGAAATGGACCCTGGAAGCCACAGGACATTTGACCTCAGCTACTACACACTTTTGCTCAAAAGACGAGGCCTCTTTCAATCTGATGCTGCTTTAACCACAAGCTCAACCACCCTT
AATTATATCAACCAGCTCCTCAAAGGTCCACTTCAGAATTTCTATGACGAATTTGCCAAGTCCATGGAGAAAATGGGTCGGGTTAATGTTAAGACTGGATCAGCTGGTGAGATTAGGAAG
CAATGTGCAGTTGTGAATAGCTAG

Retrieve as FASTA