Entry information : PpePrx26 (ppa008723m)
Entry ID 9275
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx26 (ppa008723m)
Name (synonym) PpePrx26 (ppa008723m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx26
start..stop
S start..stop
CclPrx45 555 0 1..321 1..322
PtPrx78 555 0 1..321 1..321
RcPrx09 555 0 9..321 9..321
CsPrx29 549 0 9..321 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21241443..21241643 201 N° 2 21241151..21241330 180 N° 3 21240889..21241051 163 N° 4 21240370..21240791 422
complement(join(21240370..21240791,21240889..21241051,21241151..21241330,2124144 3..21241643))


exon

Literature and cross-references PpePrx26 (ppa008723m)
DNA ref. Phytozome 11:   scaffold_7 (21241643..21240370)
Protein sequence: PpePrx26 (ppa008723m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (301)
PWM (Da):   %s   34693.6 (32434.4)  
PI (pH):   %s   7.7 (7.31) Peptide Signal:   %s   cut: 21 range:21-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKATGSFFLVILVMILPVQGQLKTLFYSSSCPKAEATIRSTVESYFNKDPTIAAGLLRLHFHDCFVQGCDGSVLIKGSSAERNALPNLGLRGFEVIDDAKAQLEALCPGVVSCADILALAARDAVDLSDGPSWSVPTGRRDGRVSLSSQASNLPSPLDSVAAQRQKFAAKGLDDHDLVTLVGAHTIGQTDCTFVRYRLYNFTATGNSDPTINQAFLAQLQALCPKDGDGSKRVALDIGSQTNFDVSFFKNVRDGNAVLESDQRLWGDASTRNIMQNYAGNIRGLLGFRFDFEFPKAMIKMSGIEVKTGAQGEIRKVCSKFN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGCCACAGGGTCGTTTTTTCTTGTCATTCTGGTAATGATTTTGCCTGTACAAGGTCAACTGAAAACTTTGTTTTACTCTTCTTCATGCCCAAAAGCAGAGGCCACAATCAGGTCC
ACGGTTGAATCATACTTCAACAAAGATCCTACCATTGCAGCTGGCCTGCTTAGGCTCCATTTCCATGACTGCTTTGTTCAG
GTTTTTGTTTTCTTCTTTTGCTGAGTGACCGAGTCTTTG
TTCATATTTTGTTAGTTTGGGCCATTTGGCATGTTACATGTTCATGCTTCTTGCTTGTGTTCATGTTCCACAGGGTTGTGATGGGTCGGTTTTGATTAAGGGCTCGTCGGCGGAGAGAAA
TGCATTGCCAAATCTTGGGTTGAGAGGATTTGAAGTAATTGATGATGCAAAAGCACAACTAGAGGCCTTGTGTCCTGGAGTTGTCTCATGTGCTGATATACTTGCACTGGCTGCTCGTGA
TGCTGTTGACTTG
GTAAAAACATACCTCTCTGTTTAGCATACACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTCTAATGATGTATTTCTTGCTGTATTAATTTCAGAGTGACGG
TCCAAGTTGGTCAGTGCCCACTGGAAGAAGAGATGGCAGGGTCTCTTTGTCATCTCAAGCCTCAAACTTACCATCTCCTCTTGATTCTGTTGCTGCCCAAAGGCAAAAGTTTGCAGCCAA
AGGCCTTGACGATCATGATCTTGTAACTCTAGTTG
GTAAGCTCTCTTTTTCAGCACAAGGGCCATAATCATTTATATGTATAATTACAAAAAGCTCCAAACTAAGCTACAAATTTATGGA
AATTGGATGCAGGGGCACATACTATTGGCCAAACAGACTGCACATTTGTCAGATACCGTCTTTACAATTTCACAGCAACTGGGAATTCTGACCCGACCATAAACCAAGCCTTCCTAGCAC
AACTCCAAGCTCTTTGCCCCAAAGATGGAGATGGTTCTAAGCGGGTGGCGTTAGATATAGGCAGCCAGACTAATTTTGATGTGAGCTTCTTCAAGAATGTGAGGGATGGCAATGCCGTTC
TGGAGTCAGACCAGAGGCTTTGGGGTGATGCTTCAACTCGCAACATAATGCAAAACTATGCTGGCAACATAAGGGGGTTGCTTGGATTTAGATTTGACTTTGAATTCCCAAAAGCTATGA
TCAAAATGAGTGGCATTGAGGTGAAAACTGGTGCACAAGGAGAGATTAGAAAAGTGTGCTCAAAATTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGCCACAGGGTCGTTTTTTCTTGTCATTCTGGTAATGATTTTGCCTGTACAAGGTCAACTGAAAACTTTGTTTTACTCTTCTTCATGCCCAAAAGCAGAGGCCACAATCAGGTCC
ACGGTTGAATCATACTTCAACAAAGATCCTACCATTGCAGCTGGCCTGCTTAGGCTCCATTTCCATGACTGCTTTGTTCAG
GGTTGTGATGGGTCGGTTTTGATTAAGGGCTCGTCGGCG
GAGAGAAATGCATTGCCAAATCTTGGGTTGAGAGGATTTGAAGTAATTGATGATGCAAAAGCACAACTAGAGGCCTTGTGTCCTGGAGTTGTCTCATGTGCTGATATACTTGCACTGGCT
GCTCGTGATGCTGTTGACTTG
AGTGACGGTCCAAGTTGGTCAGTGCCCACTGGAAGAAGAGATGGCAGGGTCTCTTTGTCATCTCAAGCCTCAAACTTACCATCTCCTCTTGATTCTGTT
GCTGCCCAAAGGCAAAAGTTTGCAGCCAAAGGCCTTGACGATCATGATCTTGTAACTCTAGTTG
GGGCACATACTATTGGCCAAACAGACTGCACATTTGTCAGATACCGTCTTTACAAT
TTCACAGCAACTGGGAATTCTGACCCGACCATAAACCAAGCCTTCCTAGCACAACTCCAAGCTCTTTGCCCCAAAGATGGAGATGGTTCTAAGCGGGTGGCGTTAGATATAGGCAGCCAG
ACTAATTTTGATGTGAGCTTCTTCAAGAATGTGAGGGATGGCAATGCCGTTCTGGAGTCAGACCAGAGGCTTTGGGGTGATGCTTCAACTCGCAACATAATGCAAAACTATGCTGGCAAC
ATAAGGGGGTTGCTTGGATTTAGATTTGACTTTGAATTCCCAAAAGCTATGATCAAAATGAGTGGCATTGAGGTGAAAACTGGTGCACAAGGAGAGATTAGAAAAGTGTGCTCAAAATTT
AACTAG

Retrieve as FASTA