Entry information : PpePrx30 (ppa008831m)
Entry ID 9277
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx30 (ppa008831m)
Name (synonym) PpePrx30 (ppa008831m)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx30
start..stop
S start..stop
EglPrx158 529 0 1..318 1..316
EcamPrx158 526 0 1..318 1..316
EgrPrx158 526 0 1..318 1..316
RcPrx13 523 0 14..318 14..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17793163..17793372 210 N° 2 17792885..17793073 189 N° 3 17792631..17792793 163 N° 4 17792134..17792528 395
complement(join(17792134..17792528,17792631..17792793,17792885..17793073,1779316 3..17793372))


exon

Literature and cross-references PpePrx30 (ppa008831m)
DNA ref. Phytozome 11:   scaffold_7 (17793372..17792134)
Protein sequence: PpePrx30 (ppa008831m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (294)
PWM (Da):   %s   34305.36 (31684.9) Transmb domain:   %s   i5-27o
PI (pH):   %s   9.29 (9.29) Peptide Signal:   %s   cut: 25 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFNLAFLSSVLIILSAFSPVITALSSNYYDKSCPNVDQIVSNAVKKAAANDRTVPAALLRMHFHDCFIRGCDASVLLNSKGSNQAEKDGPPNISLHAFYVIDNAKKQVEASCPGVVSCADILALAARDAVVQSGGPNWDVPKGRKDGRTSKATETRQLPAPTFNISQLQQSFSQRGLSLNDLVALSGGHTLGFSHCSSFQNRIHNFNATHDVDPSLRPSFAASLKNTCPINNRPKNAGATMDPSSTTFDNAYYKLILQGKSLFSSDQALLSFPKTKNLVTKFATSKEAFLDAFVNSMIKMSSITGGQEVRKDCRIVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTAATCTTGCATTCTTGAGCTCAGTCCTCATCATCCTTTCAGCCTTTTCCCCGGTGATTACCGCACTGAGCTCGAATTATTACGATAAGAGCTGTCCTAACGTTGACCAAATA
GTTTCAAATGCTGTCAAGAAAGCGGCAGCTAATGACAGAACTGTCCCGGCTGCTCTGCTCAGGATGCATTTCCATGACTGTTTCATAAGG
GTACATATGTATATTTTTTCTGTACAAGTT
GTCTGACAGTTTAAATGCACTGGTTGAGTTAGCCGAAACTTTTTCCCTTGTTTTTGCAGGGTTGTGATGCCTCTGTGTTGTTAAATTCCAAAGGGAGCAACCAAGCAGAGAAAGATGGGC
CACCAAATATTTCTTTGCATGCATTTTATGTCATTGACAATGCAAAGAAACAAGTGGAGGCTTCCTGCCCTGGTGTGGTCTCATGTGCTGATATCTTGGCTCTAGCTGCAAGGGATGCTG
TTGTGCAA
GTAAGCAAGAAAAAGTCCTCACAACTGGTTTTAAACAAAAATGACAAGAAAAAGTTCTTGCTGTTTCTGATTGTACTATTAATCTTTGCAGTCTGGAGGTCCAAACTGGGAT
GTGCCAAAAGGAAGAAAAGATGGAAGAACATCAAAGGCTACTGAAACCAGACAATTGCCAGCTCCAACCTTCAACATATCTCAACTGCAGCAGAGCTTCTCTCAGAGAGGTCTGTCCTTG
AATGACCTGGTGGCTCTTTCAG
GTAAACTAACTTCAATATCCCAATTGCAATTGCAATTGCTATTTCATATTTTTCATTTATCTCAAGAAGAAATGGAGAGCTTAACTATTGAAACATCT
GCAGGAGGTCACACTCTAGGGTTCTCTCACTGCTCATCTTTCCAAAACAGAATCCACAACTTCAATGCCACACACGACGTCGATCCTTCACTGCGACCATCCTTTGCAGCAAGCTTAAAG
AATACATGTCCCATCAATAACAGGCCAAAAAACGCTGGCGCCACCATGGATCCTTCTTCAACAACTTTTGATAACGCATACTACAAGTTGATCCTCCAGGGGAAGAGCTTGTTTTCTTCA
GACCAAGCTCTGCTTAGTTTTCCAAAGACCAAAAATTTGGTTACTAAGTTTGCTACTTCAAAGGAAGCTTTCTTAGATGCTTTTGTGAATTCTATGATTAAGATGAGTAGCATTACAGGT
GGACAAGAGGTCAGGAAAGACTGCAGGATAGTAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTTAATCTTGCATTCTTGAGCTCAGTCCTCATCATCCTTTCAGCCTTTTCCCCGGTGATTACCGCACTGAGCTCGAATTATTACGATAAGAGCTGTCCTAACGTTGACCAAATA
GTTTCAAATGCTGTCAAGAAAGCGGCAGCTAATGACAGAACTGTCCCGGCTGCTCTGCTCAGGATGCATTTCCATGACTGTTTCATAAGG
GGTTGTGATGCCTCTGTGTTGTTAAATTCC
AAAGGGAGCAACCAAGCAGAGAAAGATGGGCCACCAAATATTTCTTTGCATGCATTTTATGTCATTGACAATGCAAAGAAACAAGTGGAGGCTTCCTGCCCTGGTGTGGTCTCATGTGCT
GATATCTTGGCTCTAGCTGCAAGGGATGCTGTTGTGCAA
TCTGGAGGTCCAAACTGGGATGTGCCAAAAGGAAGAAAAGATGGAAGAACATCAAAGGCTACTGAAACCAGACAATTGCCA
GCTCCAACCTTCAACATATCTCAACTGCAGCAGAGCTTCTCTCAGAGAGGTCTGTCCTTGAATGACCTGGTGGCTCTTTCAG
GAGGTCACACTCTAGGGTTCTCTCACTGCTCATCTTTC
CAAAACAGAATCCACAACTTCAATGCCACACACGACGTCGATCCTTCACTGCGACCATCCTTTGCAGCAAGCTTAAAGAATACATGTCCCATCAATAACAGGCCAAAAAACGCTGGCGCC
ACCATGGATCCTTCTTCAACAACTTTTGATAACGCATACTACAAGTTGATCCTCCAGGGGAAGAGCTTGTTTTCTTCAGACCAAGCTCTGCTTAGTTTTCCAAAGACCAAAAATTTGGTT
ACTAAGTTTGCTACTTCAAAGGAAGCTTTCTTAGATGCTTTTGTGAATTCTATGATTAAGATGAGTAGCATTACAGGTGGACAAGAGGTCAGGAAAGACTGCAGGATAGTAAATTAA

Retrieve as FASTA