Entry information : PpePrx31 (ppa008896m)
Entry ID 9278
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx31 (ppa008896m)
Name (synonym) PpePrx31 (ppa008896m)
Class Class III peroxidase    [Orthogroup: Prx026]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx31
start..stop
S start..stop
MePrx119 508 0 1..315 4..318
GmPrx65 496 3e-179 6..315 18..328
CroPrx09 494 2e-178 7..315 4..321
GrPrx39 492 1e-177 3..315 11..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11059226..11059438 213 N° 2 11059939..11060127 189 N° 3 11060237..11060399 163 N° 4 11060601..11060983 383
join(11059226..11059438,11059939..11060127,11060237..11060399,11060601..11060983 )


exon

Literature and cross-references PpePrx31 (ppa008896m)
DNA ref. Phytozome 12:   scaffold_4 (11059226..11060983)
Protein sequence: PpePrx31 (ppa008896m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316
PWM (Da):   %s   34465.93  
PI (pH):   %s   6.39
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGIPKLLGVFLVMEMMSGFRFGAHGLSMGYYVMSCPMAELIVRNSVIRALQADPTLAAGLIRMHFHDCFIEGCDASILLDSTKDNTAEKDSPANLSLRGYEVIDAAKEELEKECPGVVSCADIVAMASTYAVFEAGGPVYDIPKGRKDGSRSKIQDTINLPPPTLNASQLIKMFGQHGFTAQEMVALSGAHTLGVARCSSFKNRLVDAVDPNLDSGFAKQLTKTCSAGDNTEQPFDGTRNHFDNLYFNALQHNTGLLASDQTLFSSARTRNIVNGYAFNQAMFFFDFQQAMVKMSMLDVKEGFKGEVRQNCRKIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATTCCTAAGCTTCTTGGTGTGTTTCTAGTAATGGAAATGATGAGTGGCTTCAGATTTGGAGCACATGGTTTGAGTATGGGATATTACGTTATGAGCTGCCCGATGGCTGAATTG
ATCGTCAGAAATTCAGTCATCAGAGCCTTGCAAGCTGATCCAACCTTAGCAGCAGGCCTAATCAGAATGCATTTCCATGACTGCTTCATAGAG
GNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCACACACAACACAAAGCATATTGTTTAAATTTGTTTAAATTTTTTAGGTTTTGTTAGAAGTACACGAAATTTTTATTAAGAAAAGCAAAAGGTTTTCTAGCATATTTATTTGAAAGTG
CTTTATGAAAAAACAGAAGAGTGCTTCTTTACGAACCACTAAATGTAATATCATAACACTATTAGAGTAACATTTAGTTTACTATTTTTAACTTTATGCTTTTTCTATTGGGTGCTATGT
GTGCTACATCTACACTCTTCCTTTGTTATTCATATATTACTTTTCAATCAGCACATTAATTACACGCAACACACACCCAAATAGTATAATGTTTTGTTTTCTTGTGTAAAGTGTTCTTTT
TCAAATGCCAAGTTCATGTTAAATTATTTTTTTAAGGGATTTAATAACTCCACATTGTAATTTCTAAATTACCAAAAAAAATAAAACCTTGTGTTTCCTTGTTGAATATTTAGGGATGTG
ATGCTTCAATTCTCCTAGATTCAACAAAAGACAACACAGCAGAGAAGGACTCCCCTGCAAATTTGAGCCTGAGAGGCTATGAAGTTATTGACGCTGCAAAAGAGGAGCTTGAAAAAGAAT
GCCCTGGCGTTGTCTCATGCGCTGACATAGTTGCAATGGCTTCTACATATGCAGTTTTTGAG
GTAATTAAGGACATATAAACTCATTCATAAATTAAATTTTGTTCTTTTTTATGTGTGT
GAAATTAATCATTAGACTTTACTGTTTGCTGTGGGATTTGATTAACAACAGGCTGGAGGTCCAGTATATGACATACCCAAAGGAAGAAAGGACGGAAGTAGGTCTAAAATACAAGACACA
ATCAACCTGCCTCCACCCACCTTGAATGCCTCTCAACTCATTAAAATGTTCGGGCAACATGGTTTTACTGCTCAAGAAATGGTGGCTCTATCTG
GTAAACATATACATACTCCCTCTTAA
AATTTACAAACGACCATGTTATGTAGCCGATTGAGTGGCAGATATTGTCCGGTCAAATCATGTAACATATGTTATATTTTAACTAGACGATACCTGCCACTCATTATGGCAGAATTTCCA
CATAAGTTTTTCTCTTAATTTAAGGGTTCATATATATTGGTTTTGTACTTCGTAGGTGCACATACACTAGGTGTAGCCAGGTGCTCTTCATTCAAAAACCGATTGGTTGATGCTGTGGAT
CCAAACTTAGATTCAGGGTTTGCAAAGCAACTGACCAAAACCTGCAGTGCCGGGGACAATACCGAGCAGCCCTTCGACGGGACGAGAAACCATTTCGATAACCTTTACTTCAATGCACTG
CAGCATAACACCGGACTGCTGGCTTCTGATCAAACTCTCTTTTCATCTGCAAGAACCAGAAACATTGTAAATGGTTATGCCTTCAACCAAGCCATGTTCTTCTTTGATTTTCAACAGGCA
ATGGTGAAAATGAGCATGCTGGATGTTAAGGAAGGTTTCAAAGGAGAAGTGCGACAAAACTGCCGCAAAATCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATTCCTAAGCTTCTTGGTGTGTTTCTAGTAATGGAAATGATGAGTGGCTTCAGATTTGGAGCACATGGTTTGAGTATGGGATATTACGTTATGAGCTGCCCGATGGCTGAATTG
ATCGTCAGAAATTCAGTCATCAGAGCCTTGCAAGCTGATCCAACCTTAGCAGCAGGCCTAATCAGAATGCATTTCCATGACTGCTTCATAGAG
GGATGTGATGCTTCAATTCTCCTAGAT
TCAACAAAAGACAACACAGCAGAGAAGGACTCCCCTGCAAATTTGAGCCTGAGAGGCTATGAAGTTATTGACGCTGCAAAAGAGGAGCTTGAAAAAGAATGCCCTGGCGTTGTCTCATGC
GCTGACATAGTTGCAATGGCTTCTACATATGCAGTTTTTGAG
GCTGGAGGTCCAGTATATGACATACCCAAAGGAAGAAAGGACGGAAGTAGGTCTAAAATACAAGACACAATCAACCTG
CCTCCACCCACCTTGAATGCCTCTCAACTCATTAAAATGTTCGGGCAACATGGTTTTACTGCTCAAGAAATGGTGGCTCTATCTG
GTGCACATACACTAGGTGTAGCCAGGTGCTCTTCA
TTCAAAAACCGATTGGTTGATGCTGTGGATCCAAACTTAGATTCAGGGTTTGCAAAGCAACTGACCAAAACCTGCAGTGCCGGGGACAATACCGAGCAGCCCTTCGACGGGACGAGAAAC
CATTTCGATAACCTTTACTTCAATGCACTGCAGCATAACACCGGACTGCTGGCTTCTGATCAAACTCTCTTTTCATCTGCAAGAACCAGAAACATTGTAAATGGTTATGCCTTCAACCAA
GCCATGTTCTTCTTTGATTTTCAACAGGCAATGGTGAAAATGAGCATGCTGGATGTTAAGGAAGGTTTCAAAGGAGAAGTGCGACAAAACTGCCGCAAAATCAATTAA

Retrieve as FASTA