Entry information : SbRboh09 (Sobic.009G206500.1[2.1] / Sb09g026320[1.4])
Entry ID 928
Creation 2008-11-15 (Christophe Dunand)
Last sequence changes 2008-11-15 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2015-12-10 (Catherine Mathe)
Peroxidase information: SbRboh09 (Sobic.009G206500.1[2.1] / Sb09g026320[1.4])
Name (synonym) SbRboh09 (Sobic.009G206500.1[2.1] / Sb09g026320[1.4])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Pannicles
Seedlings
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh09
start..stop
S start..stop
ZmRboh07 1811 0 18..957 16..948
OsRboh05 1724 0 13..957 14..951
HvRboh01 1671 0 20..957 17..963
SbRboh03 1650 0 1..957 1..944
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 55623262..55623949 688 N° 2 55623010..55623169 160 N° 3 55622843..55622891 49 N° 4 55622072..55622185 114
N° 5 55618865..55619287 423 N° 6 55618072..55618455 384 N° 7 55617886..55617981 96 N° 8 55617699..55617814 116
N° 9 55617428..55617595 168 N° 10 55617178..55617337 160 N° 11 55616766..55616963 198 N° 12 55616544..55616672 129
N° 13 55616277..55616355 79 N° 14 55615214..55615323 110  
complement(join(55615214..55615323,55616277..55616355,55616544..55616672,5561676 6..55616963,55617178..55617337,55617428..55617595,55617699..55617814,55617886..5 5617981,55618072..55618455,55618865..55619287,55622072..55622185,55622843..55622 891,55623010..55623169,55623262..55623949))


exon

Literature and cross-references SbRboh09 (Sobic.009G206500.1[2.1] / Sb09g026320[1.4])
Literature REFERENCE 1 Klein,R.R., Cordonnier-Pratt,M.-M., Gingle,A., Sudman,M. and Pratt ,L.H. An EST database from Sorghum: developing preanthesis pannicles.
DNA ref. Phytozome 11:   chromosome_9 (55623949..55615214)
EST ref. GenBank:   BI140015
Protein sequence: SbRboh09 (Sobic.009G206500.1[2.1] / Sb09g026320[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   957
PWM (Da):   %s   107231.57 Transmb domain:   %s   o396-415i534-556o576-598i755-772o
PI (pH):   %s   9.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRGGGGGGPGVGTPGRPRWGSGATTPRSLSTGSSPRGSDRSSDDGEELVEVTLDLLEDDNIVLRSVEPAAAGSAAVAAPPRRHPDPTPSSSGAPSRSRSPAMRRTSSHRLLQFSQELKATANRAKQFSQDLTKRFTRTQSRANLADPPPATGTAAAPSSGIDAALEARAQRRRRAQLDRTKSGAQRAIRGLRFISGGNKASNAWIEVQANFDRLARDGYLSRADFPKCIGMTESQEFAMELFDTLSRRRQMQVDKINKDELREIWQQITDNSFDSRLQIFFDMVDKNADGHITEAEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPEGLGYIELWQLETLLLQKDTYVNYSQALSYTSQALSQNLAGLRKRSPIRKISSTVNYYLEDNWKRLWVLAVWIGIMAGLFIWKFIQYRNRYVFDVMGYCVTTAKGAAETLKLNMALILLPVCRNTITWLRNTKAARALPFDDNINFHKTIAAAIVVGVVLHAGNHLVCDFPRLIGSSEMKYAPLRKYFGENKPTYLALVKGVEGITGVIMVVCMLIAFTLATRWFRRSLVKLPRPFDKLTGFNAFWYSHHLFIIVYIALVIHGECLYLIHDWYKKTTWMYLAVPVGLYVGERTLRFFRSGSYSVRLLKVAIYPGNVLTLQMSKPPAFRYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDYLSIHVRQLGDWTRELKRVFSAACEPPVGGKSGLLRADETTKKALPKLLIDGPYGSPAQDYSKYDVLLLVGLGIGATPFISILKDLLNNIIKMEEEEASSDLYPPIGRSKAHVDLDTLMRITSKPKRVLKTTNAYFYWVTREQGSFDWFKGVMNEIAELDQRNIIEMHNYLTSVYEEGDARSALITMLQALNHAKNGVDIVSGTKVRTHFARPNFKKVLSKIATKHPYAKIGVFYCGAPVLAQELSKLCYEFNGKSTTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, 13 introns) and 3 ESTs (BI245845, CF073108). Cultivar="BTx623".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGGAGGAGGAGGAGGAGGGCCGGGCGTCGGCACGCCGGGGCGCCCGCGATGGGGGTCCGGCGCCACGACGCCGCGGTCGCTGAGCACGGGCTCCTCGCCGCGCGGCTCCGACCGG
AGCTCCGACGACGGGGAGGAGCTGGTCGAGGTCACGCTGGACCTCCTCGAGGACGACAACATTGTGCTGCGGAGCGTCGAGCCGGCAGCGGCGGGCTCCGCCGCGGTGGCGGCTCCGCCG
CGCCGCCACCCGGACCCGACCCCGTCGTCGTCCGGGGCGCCGTCGCGGTCGCGCTCGCCCGCGATGCGCCGGACCTCCTCGCACCGCCTGCTGCAGTTCTCGCAGGAGCTCAAGGCTACC
GCCAACCGCGCCAAGCAGTTCTCGCAGGACCTCACCAAGCGCTTCACGCGCACACAGAGCCGCGCCAACCTCGCGGACCCGCCGCCGGCCACAGGCACCGCCGCGGCGCCGTCCTCGGGC
ATCGACGCCGCGCTCGAGGCCCGCGCACAGCGCCGCCGCCGCGCGCAGCTCGACCGCACCAAGTCCGGCGCGCAGCGCGCGATCCGCGGACTCCGATTCATCAGCGGCGGCAACAAGGCT
AGCAACGCCTGGATCGAGGTCCAGGCTAACTTCGACCGCCTCGCGCGCGACGGCTACCTCTCCCGCGCCGACTTTCCCAAATGCATAG
GTTCACTTCAGTCCCCTCCCCCTTTCCCTTCC
AGAAACCACAGGCTTGTTCGAGCGATTAGTTGCTAACCGCATTGGAGTTTTTGGATGCAGGGATGACGGAGTCGCAGGAGTTCGCGATGGAGCTCTTCGACACGCTGAGCCGCCGCCGGC
AGATGCAGGTGGATAAGATCAACAAGGATGAGCTGCGCGAGATCTGGCAGCAGATCACCGACAACAGCTTCGACTCGCGCCTCCAGATCTTCTTCGACAT
GTAATCCCTGCAATCTGAGA
ACTGCTATCAAATTAACGCTATGAACACATCAGTTGTTCAGTTCAATTAATGTGTCTTCGATTTTTATTTTTGTTATATATGTTATCATTTTAATCAGGGTGGATAAGAACGCAGATGGC
CATATCACGGAGGCCGAGGTGAAAGAG
GTAAACAATTCCTCGTCGCTGTGCTTGGTGTTTCACTTACGATTTTTTTTTGTTTTGTTTTTGCTCTCCCGTTTGGGGATATTTTCGTACAAT
TATTTGGGGGTCTTTTGATAACTGGGCTGTCCATTTCCATGCCTCTGTAGTTATGTACTTGTTTTTTTGTTGCCTTACAAGTTTGTGTTCCTGGATTTACGCATAAGGATTACGGAATTG
GTAGCTTGGAGAAACATTGCCGACTAATCGATGTATCGTCCCGGCGAAACTGGCGGAGAAAGCATCCCCACCACCCGCCGGTCTCCCCCACATCATTATTTTTTAGCAATCGATATTGTT
GGTTCTAGAACGTGGGAGGGGTGTTTAGTAAATTTACTATTGATGGAGATGGAACTGACCTACAGGAAGCTGGAGGCCAGAAAGCAATAGTTGGTGGGGGCATTTCTGTCATGCTTCCTA
ATTAGTACTCTAATCTACTCAAACGATGTGTGGAAAGGGGGAAGCTTTTGGATTAGAGCTTAATTTGTTTATTTAACTGAGGTCATCGTGGAAAGGGCCAGGCTAGGTTGTTTATTTGGG
TTACTTTTTTTTTCCCGATGTTTGAAAACTGAAAAATATGGTTCGTGATCAGTTGATCGAAAAATGCCGTTGTTTTGTTTCCAGATCATTATGCTGAGTGCTTCTGCTAATAAATTGTCG
AGGCTTAAGGAGCAAGCTGAGGAGTATGCAGCCTTGATCATGGAGGAACTTGATCCTGAAGGGCTTGGCTACATTGAG
GTAAATATAGCATGTCGTTGTATCCCATACTGTGTATGATCT
GAGACAAATAACTGATTCCATGATACTCTTATATTGCATGACCCCATTAGTATCCACCGATTTTGAAGGTGTTCAGGAGAAATAACCTGCGTAGAAATTGTTGAATTATTGAGTTAGTTG
ACAAAAAAAGAGTTTTGACTGCACATATTTGGGCCTGTCCAGTAATAAATTGATAAAACTGCAGGGCTGCATTAACTTGTTTTAACCAAACAACATCACAGGGTTGGTCAGTTCACCAGC
TACTATTTCTTATTTGGTGAAAATTGAAAGCGAAAGTTAACCAGCTTTTTTATTGAAAGAGTCCCATTCCTGGGTCAGTATCTGAAGGAAGATTTTGTTTTCTTGCTCCTGCCTAATCAA
ACCCTTCCATTGATCTCCTCCAACTTTCCTGCATGCCAGTCTAAGGGTCCCTTTGGTTGGGCTTTTGAACCTGCTTTTGCTTTTGTAAAAGCCAAAAGCCAACCAAAGGGCCCAAAAGCC
ACAAGTGCTTTTGCCCAAAAGCAGCTTTTCTCGTAGTACAAATCCAAAAACACCTCACCCCCTGCTTTCACTGACTTTTGGGATCCGTTCAGTTTTTTTTCCAAAAGGCACAAGTGACCA
ACCAAATGACTTTTGGGTTTCTCAAAGCCCACATCCCACAGCAGCTTTTCAAAAGCTCAAAGCTCACAGTAGCTTTTCCAAAAGTCACAGCCCAACCAAACACACCCTAATCTTGGTCAT
CCCTGCTTCCCTTCTGTACATCTACTTAACATACCAGAATGCAGTGGTCTGTGGCCATAACCATCTAGCTCATGTTTGGTCTGGAAAAAAGTCTCTTATTTTACTATTTCTCCTAGTGCT
TGCTCCTCATGTACCTTTTGGAGTTCTATCTCCATTTTTTTAACTGTGCAGTTGAGTTTCTTTCTATTCTTTAAAATGTAACCACCTGACTTCATCTAAGGAGACTCTTTGATCTTTATA
TCTGAAGACGTTATACATGGGTTCACTTGTGGTTGCATCTAGTAGCAAAACCGCAAAAGTATTTTAGCTCTAGCGAGCACATTGTAGGAGTATATTGTAACTTAAACATCTATGTTGTGA
GCACTCATATTACACAAGGGAGCCTAGCCATGGCAGCTTAAATTGTTTCCTAGCTACTGTAAAATCTGATGAGGACACCAAGCTCCAGCTGCGGGGACCAAAAATCTACAGGTCGCTCTC
ATCAACATGATATTTAAATAATCTGATTTCTTGATAAAAATCTCTATATTTAAATAACCAGCTGTTTGGAGAAACTTGCATCCATCCTCTACTTTTACTCTTCAGCAAGGCAGAGCACAC
AGTATGATGACTGTTTTCAGTTAATATAAGATTTTTTTTAAAGAAATCTGTTGATATAAGATCATGTTTCATATCTGATACAAAATTTTTAGTGAAAAAATGAATCCTATAAAAAAAGAT
ACAAATTACCATCCATACTGAATCCTAGACTTAACGTGCTCTTAGTTTTTTTTGTGTGTAAATGAAGCATTATGGTAGGGGTGAAAACAGTAAGAAGCGGTACTATAATATGGAAACGAA
AGCGGCCAGTATGGGATTTTTCCATTTTTATCAAAATAAGTAATGAAAAAAGGGTAAAAAACAGATGTACTAAATTCACGAAATGATGACTTGTTTTGATAAAAGTGTAAACAGTATCAT
AATACAGAGAATGTATTGGTCGGTACGGGATTTTCCTGTACCGCTTTCAACCCTCGCAGGGCATCTGCTTCTCCATTTAGTCCCAAATGGCTGCATTTGTCAAATGCAAGATTAGGTGTC
TAGAACTCTAGATGTCATTCCTTGAAGGACAACAATCATAACAATTGCTTTCAATAGTATTATTAGGTGTCTAGTACTAACTATATTTTGTTGAACAAAGTAACACATCTTTATTTTCAG
ATAATCCTATGCAGTATTGCTATTTTTGTACTTGTGTAATTTCAGTCCTCAGATGTGAGTACAACTGAGAGTCTGAGAATCAAGTTCATGTCCCACCTTTTCACAATGGAATTATTGCGT
GCATGTTCTACAAGATTGTGGCATGTATGATGGGCTCATATGGGGAGCCATGTGCGCCACCAGATGCAATTATAGTCTTGAAGGGACCACCTGCAGTCTGGTGGAGTGTTTGACTTTTGT
CCCTTAGATTGACATGTATGGTTAACCTGCTTCTTTTTCTCCTGAGAAGTGTAATTATGGATTCTCAGGAGATGACGCTCTGAACTATTATTGTTAATTCACTTAGATGCGACCATATTT
TATGTGCTAATAAATGAAATTACTGTAAGCATAGAATCATTCATGAAGTTAGCTATCAAATATCTAATCGTTATGCTGAATCTGAAGCTATACCTGTGCAATTGAGCAGTTATACTTCTC
TGAAGTCAACAAGGATATTTTTGCTTTTCCTTTTGTCTAGGGAGATCCTCACTGCACAATATTCTAAAAGGTTTTTGTAGTTTTGCTCTTTAATTTCAGCACGAATTTATCATATGCACC
GCATTTTAAATGCACTATGTTTACATGTACGTCTGTACATACTATTATTATTTTTATATGTGTGCCTGATCAATGACCTGTTGGTTGAAACCTGCAAAACAAACATCTTTGGAAAAAATG
CTCTATAGTTATTTTTTTCCCAAATTGGCCTGGTGTTAGGGAGGGATGTAGAGTGCAATTGTGTGACATATTGATTTTTTTTTCTTTTTGTTGTCATTGCAGCTTTGGCAATTGGAGACA
CTGCTACTGCAAAAGGATACCTATGTGAACTACAGCCAGGCCTTGAGTTACACAAGCCAGGCACTAAGCCAGAACCTTGCTGGTCTGAGGAAAAGAAGTCCAATCCGAAAAATTAGCAGC
ACGGTGAACTACTATCTGGAGGACAACTGGAAACGTCTCTGGGTGCTTGCAGTGTGGATTGGAATAATGGCTGGGTTGTTCATTTGGAAGTTCATTCAGTACCGTAACCGTTATGTCTTT
GATGTGATGGGCTACTGTGTCACAACTGCGAAAGGTGCTGCAGAGACTCTCAAACTGAACATGGCGCTTATTCTCTTGCCTGTATGCCGCAACACTATCACCTGGCTGCGGAATACTAAA
GCTGCACGAGCATTGCCGTTCGATGACAACATAAACTTCCATAAG
GTTAGCCCTAGACTCCAATTAGTTCTTTATGCCCCTTCAAAATGGGGCTGGAGGGTCGTGGACTCGTGGTACAGC
TTTAGGGTTTACAAATTGTTGTGTGTTTATGAGATATGTTACACATTTTCATCATCTTTACTTTGTTTAAAAGTCAGTACATGCGCCATGATTTTATCATAGCAATTTAGCTAAAAGTAG
AAGTCGGGCAATGCCATGTCAAGGCAACTCATGGCTGACCTTTTCTTATTGGCTGTGAATGTAACAAAAAAATAATCATAAGTATAATGGGGACATTAGTGGTGCCTGATAAGTTTTTTT
TTCATAATAAGGACATACATGTGACATGTGATTTAGCCAGACCAAGAATGTAACTAAAACAACAATTTTTCTTTTGCTTGTTTTGTAATGGCAGACTATTGCAGCAGCAATTGTGGTTGG
TGTTGTTCTTCATGCAGGGAACCACCTTGTATGTGATTTTCCACGGCTCATTGGTTCATCAGAGATGAAGTATGCTCCGCTGCGCAAATACTTTGGGGAAAATAAACCAACATATCTAGC
TCTGGTAAAAGGAGTGGAGGGCATAACAGGGGTAATCATGGTTGTGTGCATGCTTATCGCTTTTACTCTAGCAACAAGGTGGTTCCGCCGTAGCCTGGTGAAGCTTCCAAGGCCATTTGA
CAAACTAACTGGCTTCAATGCATTCTGGTACTCCCATCATCTGTTCATCATTGTGTACATAGCACTTGTTATTCATGGAGAGTGTCTATACCTTATCCATGACTGGTACAAAAAGACG
GT
GAGCTAATCTCATCTTCATTTTTTATTCTGTGTACTCCTTGGACCTCAGTAACATTTTAAGTATCTAATATCCTTTTATTTTGTACAGACATGGATGTACCTTGCTGTTCCTGTTGGTCT
GTATGTAGGGGAAAGGACTCTGAGGTTTTTCAGATCAGGCAGTTATTCTGTTCGGTTATTGAAG
GTAACCTTCACATATTTAGAAATCTGAGTATTAATATGTTTACAGTCCTCTGACCC
ATGGTTCCTTTGCAGGTGGCTATATATCCTGGTAATGTTTTGACATTGCAGATGTCTAAACCTCCTGCATTCCGTTACAAGAGCGGACAGTATATGTTTGTTCAATGCCCTGCAGTTTCA
CCTTTTGAATG
GTGTGTAGATCTTCTTTGTAACTAAACTCGAGCTAGCTCACAAAGTCATGTTTCTGGAGTCTGGACACTAGAATATATGCTTAAACACTCGTTCTTCTTTCAGGCATCC
TTTCTCAATTACTTCAGCACCTGGGGATGACTATTTAAGCATTCATGTTCGACAACTTGGTGACTGGACACGGGAGCTCAAGCGGGTATTCTCAGCAGCTTGTGAGCCACCGGTGGGTGG
GAAAAGTGGCCTTCTTCGAGCAGACGAGACAACTAAGAAAGC
GTGTGTTTTCTTCTTCCCCATATGCATCTCAACACTTAATAATATGTTTTTTTTTCTATTTGGGGCTTCATGGTTTTT
TGGGAAATGCAGGTTACCAAAACTTTTGATTGATGGACCATATGGTTCTCCTGCACAAGACTACAGCAAGTATGATGTTCTACTACTTGTCGGATTAGGAATTGGTGCCACACCTTTTAT
TAGCATACTGAAAGACCTGCTCAATAACATCATCAAAATGGAAGAAGAGGAA
GTAAGCGATCTTTCTCATATCCCCAACTGGCCTCTTATATTATTATATTAAAAAGACAAAAACTGGCC
TCTTATTTTCTGTTTTGTGATCTAGGAATTAACAATCATTGTAATTCTTGTTTTCTTTCTATTTAGTTAGTCATCTATTCAAACATTCTTCCTCATTAATACCAGACTTGGACCAGTAAT
TAATTTATTCACGATAAAATTTGCAGGAAGCTTCAAGTGATCTTTACCCACCAATTGGTCGCAGCAAGGCACATGTTGATCTTGACACCCTTATGAGGATTACCTCAAAACCAAAGAGGG
TACTGAAGACAACAAATGCTTACTTTTATTGGGTGACACGTGAACAAGGGTCTTTTGATTGGTTTAAAGGGGTCATGAATGAAATTGCTGAACTAGATCAGAGG
GTATGTATCATCAAGC
CGTTATCTTTTAGAAATCATGATATTTGGTTTTGCCTTTGCAAATTTGTTCTTACAGATGCTCTTGTTCAATACTAGAATATCATTGAGATGCACAACTATCTCACAAGTGTTTACGAGG
AAGGGGATGCCCGGTCAGCACTCATTACAATGCTACAAGCTCTCAACCATGCCAAGAATGGTGTTGATATAGTTTCTGGAACTAAA
GTAAGTTCCAGCACTCCAATATGCATCACACTCT
AAAGCATAAAAACGTCATTGTAGTATAGGATAAGAAAACATGTGGAATAACTTGTCATTTGGTACCAAATGATATGTTGTTCTTTTTTTTCCTACCCCAACTCGCTTGGAAGAAAAATCT
TTGTTTTTGTTGTTCTGATAAGCTGTTTTTGCAGGTGCGGACACATTTTGCAAGACCAAATTTTAAGAAGGTCCTATCTAAGATAGCTACCAAACATCCATATGCTAAGATAGGTCAGAT
ACGTTTCATATTCCTGATATAGTTGAAAGCTACCTTTTATCCTTTTAGCTGTGAATATCCTTCAGGATAGTTTTGTTAACTCCTTTATAAATCATTTTTAGCTGTGAATATCCTTCAGGA
TAGTTTTGTTAACTCCTTTATAAAACCTGAACTAGCTCATGCATATAACTAAAGCAAGAAACTTCCTAGATCTCAGTAAAAGTAGGTGGTTACTATGAACTTAGGGTGTGTTTGGTTGGA
GGAATCACTCCATTCTAGATTAGGTGGTTATGAATCCATTCCTCATACTAGTACTAATTATTAGCTTGTGAGGAATGAGGCGATGATGCATCAGCCTATTCCATTCCACAAACCAAACAA
AAAAGTGAGGAATGAGTAGATGATGGACTAACTCATTTCTCAAACCAAACACACCATTAATGAGCAGACATGGGTAAGGACTTGAAAGCCTCCTTGCAGAAACAAGGACTGTTGGAACTC
TATACTTTTGTTTTTGGCGGCCTTGTTTAGTTCCCCAAAAATTTTGCAAAATTTTTCAGATTTCCCGTCACATCGAATCTTTAGACGTATGCATGGAGTATTAAATATAGATAAAAATAA
AAACTAATTGCACAGTTTAGTCGGAATTGACGAGACGAATCTTTTGAGCCTAGTTAGTCCATGATTGAACAATATTTGTCAAATACAAACGAAATTGCTACAGTGCTCATTTTGCCAAAA
ATTTTGGAACTAAACAAGGCCTAATTTTGGGCCTGTATAGTTCAGACCATGGGAAAGCTGCCTGGCCCAGGCAGCAACCTGGCCAGGGCAACAAAGCATGTCCATATATCCCAAAAAGAA
ATATTTAGGGGGTAAATAACGGCCACTTCTGGCCGAAGTAGTAATCTTGGTCCCATCTTCTATGATATGATCACTGTAAGAAGGTAATTGTTGTTATTGTGTACAGGAGTGTTCTATTGT
GGGGCTCCAGTTCTGGCACAGGAACTAAGCAAACTCTGTTATGAATTCAATGGCAAGTCTACAACAAAATTCGAATTCCACAAGGAACATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGGAGGAGGAGGAGGAGGGCCGGGCGTCGGCACGCCGGGGCGCCCGCGATGGGGGTCCGGCGCCACGACGCCGCGGTCGCTGAGCACGGGCTCCTCGCCGCGCGGCTCCGACCGG
AGCTCCGACGACGGGGAGGAGCTGGTCGAGGTCACGCTGGACCTCCTCGAGGACGACAACATTGTGCTGCGGAGCGTCGAGCCGGCAGCGGCGGGCTCCGCCGCGGTGGCGGCTCCGCCG
CGCCGCCACCCGGACCCGACCCCGTCGTCGTCCGGGGCGCCGTCGCGGTCGCGCTCGCCCGCGATGCGCCGGACCTCCTCGCACCGCCTGCTGCAGTTCTCGCAGGAGCTCAAGGCTACC
GCCAACCGCGCCAAGCAGTTCTCGCAGGACCTCACCAAGCGCTTCACGCGCACACAGAGCCGCGCCAACCTCGCGGACCCGCCGCCGGCCACAGGCACCGCCGCGGCGCCGTCCTCGGGC
ATCGACGCCGCGCTCGAGGCCCGCGCACAGCGCCGCCGCCGCGCGCAGCTCGACCGCACCAAGTCCGGCGCGCAGCGCGCGATCCGCGGACTCCGATTCATCAGCGGCGGCAACAAGGCT
AGCAACGCCTGGATCGAGGTCCAGGCTAACTTCGACCGCCTCGCGCGCGACGGCTACCTCTCCCGCGCCGACTTTCCCAAATGCATAG
GGATGACGGAGTCGCAGGAGTTCGCGATGGAG
CTCTTCGACACGCTGAGCCGCCGCCGGCAGATGCAGGTGGATAAGATCAACAAGGATGAGCTGCGCGAGATCTGGCAGCAGATCACCGACAACAGCTTCGACTCGCGCCTCCAGATCTTC
TTCGACAT
GGTGGATAAGAACGCAGATGGCCATATCACGGAGGCCGAGGTGAAAGAGATCATTATGCTGAGTGCTTCTGCTAATAAATTGTCGAGGCTTAAGGAGCAAGCTGAGGAGTAT
GCAGCCTTGATCATGGAGGAACTTGATCCTGAAGGGCTTGGCTACATTGAG
CTTTGGCAATTGGAGACACTGCTACTGCAAAAGGATACCTATGTGAACTACAGCCAGGCCTTGAGTTAC
ACAAGCCAGGCACTAAGCCAGAACCTTGCTGGTCTGAGGAAAAGAAGTCCAATCCGAAAAATTAGCAGCACGGTGAACTACTATCTGGAGGACAACTGGAAACGTCTCTGGGTGCTTGCA
GTGTGGATTGGAATAATGGCTGGGTTGTTCATTTGGAAGTTCATTCAGTACCGTAACCGTTATGTCTTTGATGTGATGGGCTACTGTGTCACAACTGCGAAAGGTGCTGCAGAGACTCTC
AAACTGAACATGGCGCTTATTCTCTTGCCTGTATGCCGCAACACTATCACCTGGCTGCGGAATACTAAAGCTGCACGAGCATTGCCGTTCGATGACAACATAAACTTCCATAAG
ACTATT
GCAGCAGCAATTGTGGTTGGTGTTGTTCTTCATGCAGGGAACCACCTTGTATGTGATTTTCCACGGCTCATTGGTTCATCAGAGATGAAGTATGCTCCGCTGCGCAAATACTTTGGGGAA
AATAAACCAACATATCTAGCTCTGGTAAAAGGAGTGGAGGGCATAACAGGGGTAATCATGGTTGTGTGCATGCTTATCGCTTTTACTCTAGCAACAAGGTGGTTCCGCCGTAGCCTGGTG
AAGCTTCCAAGGCCATTTGACAAACTAACTGGCTTCAATGCATTCTGGTACTCCCATCATCTGTTCATCATTGTGTACATAGCACTTGTTATTCATGGAGAGTGTCTATACCTTATCCAT
GACTGGTACAAAAAGACG
ACATGGATGTACCTTGCTGTTCCTGTTGGTCTGTATGTAGGGGAAAGGACTCTGAGGTTTTTCAGATCAGGCAGTTATTCTGTTCGGTTATTGAAGGTGGCT
ATATATCCTGGTAATGTTTTGACATTGCAGATGTCTAAACCTCCTGCATTCCGTTACAAGAGCGGACAGTATATGTTTGTTCAATGCCCTGCAGTTTCACCTTTTGAATG
GCATCCTTTC
TCAATTACTTCAGCACCTGGGGATGACTATTTAAGCATTCATGTTCGACAACTTGGTGACTGGACACGGGAGCTCAAGCGGGTATTCTCAGCAGCTTGTGAGCCACCGGTGGGTGGGAAA
AGTGGCCTTCTTCGAGCAGACGAGACAACTAAGAAAGC
GTTACCAAAACTTTTGATTGATGGACCATATGGTTCTCCTGCACAAGACTACAGCAAGTATGATGTTCTACTACTTGTCGGA
TTAGGAATTGGTGCCACACCTTTTATTAGCATACTGAAAGACCTGCTCAATAACATCATCAAAATGGAAGAAGAGGAA
GAAGCTTCAAGTGATCTTTACCCACCAATTGGTCGCAGCAAG
GCACATGTTGATCTTGACACCCTTATGAGGATTACCTCAAAACCAAAGAGGGTACTGAAGACAACAAATGCTTACTTTTATTGGGTGACACGTGAACAAGGGTCTTTTGATTGGTTTAAA
GGGGTCATGAATGAAATTGCTGAACTAGATCAGAGG
AATATCATTGAGATGCACAACTATCTCACAAGTGTTTACGAGGAAGGGGATGCCCGGTCAGCACTCATTACAATGCTACAAGCT
CTCAACCATGCCAAGAATGGTGTTGATATAGTTTCTGGAACTAAA
GTGCGGACACATTTTGCAAGACCAAATTTTAAGAAGGTCCTATCTAAGATAGCTACCAAACATCCATATGCTAAG
ATAG
GAGTGTTCTATTGTGGGGCTCCAGTTCTGGCACAGGAACTAAGCAAACTCTGTTATGAATTCAATGGCAAGTCTACAACAAAATTCGAATTCCACAAGGAACATTTCTGA

Retrieve as FASTA