Entry information : PpePrx40 (ppa014723m)
Entry ID 9281
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx40 (ppa014723m)
Name (synonym) PpePrx40 (ppa014723m)
Class Class III peroxidase    [Orthogroup: Prx064]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx40
start..stop
S start..stop
PpePrx46 466 2e-166 19..335 23..339
GmPrx189 298 1e-100 33..335 28..328
GmPrx195 296 8e-100 33..335 28..328
OsPrx34 291 3e-98 32..335 26..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 25073872..25074102 231 N° 2 25072944..25073720 777  
complement(join(25072944..25073720,25073872..25074102))


exon

Literature and cross-references PpePrx40 (ppa014723m)
DNA ref. Phytozome 12:   scaffold_1 (25074102..25072944)
Protein sequence: PpePrx40 (ppa014723m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (312)
PWM (Da):   %s   37072.85 (34393.4)  
PI (pH):   %s   6.5 (6.71) Peptide Signal:   %s   cut: 24 range:24-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MITTATFFTLCIIITIIVPWSEAAGQSTGNGLRVGFYSRSCPNVEKIVADIVLKAHQDDLKLPAALIRFFSHDCLVKGCDASILLDATASHEPVEKQAQASEMLRGYELIDEIKDRVEQECPQTVSCADILAFAAREAVFLAGLPRHMVPSGRRDSRTSRASDITIPNPTTPFDEIIDYFSRRGITIDEMVVLSGAHSIGIAHCSFFDYRLYTFNKDQPQDPALNASYASELSKTCPKPNTLNPAEAKQRNVELDPTTPLVLDNHHYLNLLQGKALLQSDQTMVTDPRTSGLVQQFALDPESWARRFAKAMIKMGRINVLTGNVGEIRKNCRAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Short 5' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCACCACAGCAACCTTCTTCACCTTGTGCATCATCATCACCATCATCGTTCCTTGGTCAGAGGCAGCTGGACAAAGCACTGGGAACGGCTTACGTGTCGGCTTTTACAGCCGCAGT
TGCCCAAATGTGGAAAAAATTGTTGCTGACATTGTGTTAAAGGCTCATCAGGATGATCTAAAGCTCCCCGCCGCCCTCATTCGCTTCTTCTCCCACGATTGCTTGGTCAAG
GTAAGTCCA
TATACATCCGGATTGGATAAAACTATTTGTACCATATCGACTGAACATCTCTAGTAATAACAACACGTCGCAAATGGTACAAATAGTATGAGTTGAAATCATGCTCCTCCTTAATGAATT
GCATGGGTTATTAACATTACAGGGCTGCGATGCCTCAATTCTTCTGGATGCCACAGCCTCACATGAGCCTGTAGAGAAGCAAGCACAAGCCAGTGAAATGCTTAGAGGTTATGAGCTCAT
TGATGAGATCAAGGACAGGGTAGAGCAGGAGTGTCCACAAACTGTCTCTTGCGCTGACATACTAGCCTTTGCTGCTCGGGAAGCTGTTTTTCTGGCCGGTCTGCCACGTCACATGGTCCC
CTCTGGACGCCGTGACAGTCGGACTTCCCGTGCTTCTGACATCACCATCCCTAACCCTACAACACCTTTCGATGAGATCATAGATTATTTCTCCAGAAGAGGTATCACCATTGACGAAAT
GGTTGTGTTGAGTGGTGCACATTCCATTGGGATTGCTCATTGCAGCTTCTTTGACTACAGACTCTACACCTTCAACAAAGACCAGCCCCAAGACCCTGCCCTCAACGCATCCTACGCTTC
TGAGCTGTCTAAAACGTGCCCAAAACCCAACACATTGAATCCAGCTGAGGCTAAACAGAGAAACGTCGAGTTAGATCCCACAACACCACTCGTCCTGGACAATCACCACTACCTGAACCT
GTTGCAAGGGAAAGCCTTGCTTCAGTCGGATCAGACAATGGTTACTGATCCCCGCACCAGCGGATTGGTGCAGCAGTTTGCCTTGGATCCCGAATCTTGGGCTCGAAGATTTGCCAAGGC
CATGATTAAGATGGGGAGAATCAATGTTCTCACTGGAAATGTTGGAGAGATAAGGAAAAATTGTCGGGCCATCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCACCACAGCAACCTTCTTCACCTTGTGCATCATCATCACCATCATCGTTCCTTGGTCAGAGGCAGCTGGACAAAGCACTGGGAACGGCTTACGTGTCGGCTTTTACAGCCGCAGT
TGCCCAAATGTGGAAAAAATTGTTGCTGACATTGTGTTAAAGGCTCATCAGGATGATCTAAAGCTCCCCGCCGCCCTCATTCGCTTCTTCTCCCACGATTGCTTGGTCAAG
GGCTGCGAT
GCCTCAATTCTTCTGGATGCCACAGCCTCACATGAGCCTGTAGAGAAGCAAGCACAAGCCAGTGAAATGCTTAGAGGTTATGAGCTCATTGATGAGATCAAGGACAGGGTAGAGCAGGAG
TGTCCACAAACTGTCTCTTGCGCTGACATACTAGCCTTTGCTGCTCGGGAAGCTGTTTTTCTGGCCGGTCTGCCACGTCACATGGTCCCCTCTGGACGCCGTGACAGTCGGACTTCCCGT
GCTTCTGACATCACCATCCCTAACCCTACAACACCTTTCGATGAGATCATAGATTATTTCTCCAGAAGAGGTATCACCATTGACGAAATGGTTGTGTTGAGTGGTGCACATTCCATTGGG
ATTGCTCATTGCAGCTTCTTTGACTACAGACTCTACACCTTCAACAAAGACCAGCCCCAAGACCCTGCCCTCAACGCATCCTACGCTTCTGAGCTGTCTAAAACGTGCCCAAAACCCAAC
ACATTGAATCCAGCTGAGGCTAAACAGAGAAACGTCGAGTTAGATCCCACAACACCACTCGTCCTGGACAATCACCACTACCTGAACCTGTTGCAAGGGAAAGCCTTGCTTCAGTCGGAT
CAGACAATGGTTACTGATCCCCGCACCAGCGGATTGGTGCAGCAGTTTGCCTTGGATCCCGAATCTTGGGCTCGAAGATTTGCCAAGGCCATGATTAAGATGGGGAGAATCAATGTTCTC
ACTGGAAATGTTGGAGAGATAAGGAAAAATTGTCGGGCCATCAACTAA

Retrieve as FASTA