Entry information : PpePrx44 (ppa015674m)
Entry ID 9285
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx44 (ppa015674m)
Name (synonym) PpePrx44 (ppa015674m)
Class Class III peroxidase    [Orthogroup: Prx067]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx44
start..stop
S start..stop
EgrPrx129 432 1e-153 12..331 8..323
EcamPrx129-2 429 3e-152 12..331 8..323
EglPrx130 427 2e-151 12..331 8..323
EgrPrx130 427 2e-151 12..331 8..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10302250..10302471 222 N° 2 10303628..10304401 774  
join(10302250..10302471,10303628..10304401)


exon

Literature and cross-references PpePrx44 (ppa015674m)
DNA ref. Phytozome 12:   scaffold_1 (10302250..10304401)
Protein sequence: PpePrx44 (ppa015674m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (305)
PWM (Da):   %s   35585.04 (32751.4) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.56 (8.56) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLLFISLPLLLIIMAVVLVTPAISVPLKIGFYQTACPSAESMVRNTVTKALAADPAIAAALIRLHFHDCFVRGCDASILLDSKPGMPAEKESTMNKGVQGFEVIDEAKAAIEAQCPNTVSCADIIAFAARDSVFSAGGLRYAVAGGRRDGLASLIYEAAKNLPGAFFNSTELRGNFARKGLSMEEMVTLSGAHSIGESHCSAFSKRLYSFSARFPQDPSMDGAYAETLKSKCPRPRNLTDSVDPVVAFDLSTPALLDNNYYKNLVSHRGLLASDQELWSSGLTRKMVKYNRNHPGAWASKFAAAMVKMGSIDVMVGRNGEIRNNCRAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAGCTTATTGTTTATTTCCTTACCTTTGTTGCTGATCATCATGGCAGTGGTTTTAGTCACACCAGCGATTTCTGTGCCTCTGAAAATTGGTTTCTACCAGACTGCATGCCCCTCG
GCTGAGAGCATGGTGAGAAATACAGTCACTAAGGCACTTGCCGCAGATCCTGCCATAGCTGCTGCCCTCATCAGACTCCATTTCCACGACTGTTTTGTAAGG
GTATGAAATAATAATATA
TTTCACTTCTGATAATTTTCTTATTATATGCAAAATATTTATTAAATTTTCATTCGTACTAAAATGCTTTCTTTGCCAGACTGATTGCCTAGATTATGACCATTGGTTCAGTTGTTATTG
ATATATATTTGTTTTTTGGAATGTGTAGGTTCACGTATAATACTCATATTATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTTTGTTTCCTGTATATTTTTTAAAAATACAGTTATGTGAATAGGGATTAGTT
GAGGTGCGCGCAAGTGGGCCCGGACACCTCATGGTACAATACACGCATGAATACACATTTTGTTACCAATTTTGAAAAATACAGATAAAAGTCACGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCATATCGTGGCTGAATTTTTATCAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTTTTCGTAATTTTATTATTATTTATG
ACTATAGTACCAGTTTAGAGTACGTATGACAGATTTGATCGTGTATAATATTATTCAGGGTTGTGATGCTTCTATTCTGCTTGATTCTAAGCCGGGAATGCCAGCAGAGAAAGAAAGCAC
GATGAACAAAGGCGTCCAAGGCTTTGAGGTGATAGACGAAGCAAAGGCGGCGATAGAAGCCCAATGCCCAAACACAGTTTCCTGCGCAGACATCATCGCCTTCGCCGCCAGAGACAGCGT
TTTCAGTGCCGGCGGCCTCCGCTATGCTGTCGCTGGCGGAAGGCGCGACGGCTTGGCTTCGTTGATCTACGAAGCGGCCAAAAATCTCCCCGGTGCATTTTTCAATTCGACAGAGTTGAG
GGGCAACTTTGCAAGAAAAGGGCTGTCAATGGAGGAAATGGTGACGCTCTCTGGAGCTCACTCCATTGGAGAGTCTCATTGCTCTGCCTTCTCCAAAAGGCTTTACTCTTTCAGTGCAAG
ATTTCCACAAGACCCTTCGATGGATGGGGCTTATGCTGAAACTTTAAAATCTAAATGCCCAAGGCCTCGGAATTTGACAGATTCTGTTGACCCAGTTGTGGCTTTTGATCTCTCAACGCC
TGCTCTGCTTGACAACAACTACTACAAGAACTTGGTGAGCCACAGAGGGCTATTGGCTTCTGATCAGGAGCTTTGGAGCAGTGGGTTGACGAGGAAGATGGTGAAGTACAACAGGAACCA
TCCGGGTGCATGGGCCTCTAAGTTTGCTGCTGCAATGGTGAAGATGGGTTCCATTGATGTGATGGTGGGTAGAAATGGAGAAATCAGGAACAACTGCAGGGCTGTGAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAGCTTATTGTTTATTTCCTTACCTTTGTTGCTGATCATCATGGCAGTGGTTTTAGTCACACCAGCGATTTCTGTGCCTCTGAAAATTGGTTTCTACCAGACTGCATGCCCCTCG
GCTGAGAGCATGGTGAGAAATACAGTCACTAAGGCACTTGCCGCAGATCCTGCCATAGCTGCTGCCCTCATCAGACTCCATTTCCACGACTGTTTTGTAAGG
GGTTGTGATGCTTCTATT
CTGCTTGATTCTAAGCCGGGAATGCCAGCAGAGAAAGAAAGCACGATGAACAAAGGCGTCCAAGGCTTTGAGGTGATAGACGAAGCAAAGGCGGCGATAGAAGCCCAATGCCCAAACACA
GTTTCCTGCGCAGACATCATCGCCTTCGCCGCCAGAGACAGCGTTTTCAGTGCCGGCGGCCTCCGCTATGCTGTCGCTGGCGGAAGGCGCGACGGCTTGGCTTCGTTGATCTACGAAGCG
GCCAAAAATCTCCCCGGTGCATTTTTCAATTCGACAGAGTTGAGGGGCAACTTTGCAAGAAAAGGGCTGTCAATGGAGGAAATGGTGACGCTCTCTGGAGCTCACTCCATTGGAGAGTCT
CATTGCTCTGCCTTCTCCAAAAGGCTTTACTCTTTCAGTGCAAGATTTCCACAAGACCCTTCGATGGATGGGGCTTATGCTGAAACTTTAAAATCTAAATGCCCAAGGCCTCGGAATTTG
ACAGATTCTGTTGACCCAGTTGTGGCTTTTGATCTCTCAACGCCTGCTCTGCTTGACAACAACTACTACAAGAACTTGGTGAGCCACAGAGGGCTATTGGCTTCTGATCAGGAGCTTTGG
AGCAGTGGGTTGACGAGGAAGATGGTGAAGTACAACAGGAACCATCCGGGTGCATGGGCCTCTAAGTTTGCTGCTGCAATGGTGAAGATGGGTTCCATTGATGTGATGGTGGGTAGAAAT
GGAGAAATCAGGAACAACTGCAGGGCTGTGAATTAG

Retrieve as FASTA