Entry information : PpePrx48 (ppa017309m)
Entry ID 9288
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx48 (ppa017309m)
Name (synonym) PpePrx48 (ppa017309m)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx48
start..stop
S start..stop
VvPrx76 531 0 1..319 1..321
MePrx27 530 0 1..319 1..326
PtPrx68 523 0 1..319 1..322
PbPrx68 522 0 1..319 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23456081..23456290 210 N° 2 23456551..23456742 192 N° 3 23456840..23457005 166 N° 4 23457323..23457714 392
join(23456081..23456290,23456551..23456742,23456840..23457005,23457323..23457714 )


exon

Literature and cross-references PpePrx48 (ppa017309m)
DNA ref. Phytozome 12:   scaffold_2 (23456081..23457714)
Protein sequence: PpePrx48 (ppa017309m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34188.2 (31852.0)  
PI (pH):   %s   9.36 (9.36) Peptide Signal:   %s   cut: 24 range:24-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSSFMAILTLALLLQTATSNAQLSTNFYSSSCPRVFSTVRSTVQSAIRKEARIGASLLRLHFHDCFVNGCDGSLLLDDTSSFTGEKNAVPNRNSARGFDVVDNIKSAVENVCPGVVSCADILAIASRDSVAILGGPSWNVKVGRRDARTASQAAANNGIPPPTSNLNQLISRFNALGLSTRDLVALSGSHTIGQSRCIQFRPRIYNETNLDSSFAQTRRSNCPRAAGSGDNNLAPLDLQTPTAFDNNYFKNLIQNKGLLHSDQQLFNGGSTDSIVRTYSNSYNTFSSDFVSAIIKMGDIKPLTGSNGEIRKNCRKPN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCTTCTTTCATGGCCATTTTGACCTTGGCTCTCCTTCTGCAAACGGCCACTTCAAATGCTCAACTTTCAACAAATTTCTACTCTAGCTCTTGCCCGAGGGTCTTCTCCACT
GTGAGATCCACAGTGCAATCCGCTATACGAAAGGAGGCCCGAATTGGGGCCTCCCTTCTCCGCCTCCACTTCCACGACTGTTTCGTTAAT
GTATGCTCAAAAAAAAAAATTTGTTACATA
CCTAGGTTTCAAATTTGTATTATATTTATGTATCAAACATGACATCATGAGCCAAAAGGTCAACAAAATTGTCTGCGTTATAAAGTACCTGCATGCATTACATATATGATGTCTTTGAAA
ATACAAGTTTGACAAATTGGTTTCTACACGTACTCTAAGATGTCGTTGTCTAGGTTAACTAATTTCTCTCTTCATTGGGTTTAATGTCTTAATAAATTGCCCATTTCCAGGGATGCGATG
GCTCCTTGCTCCTCGACGACACGTCGAGCTTCACTGGAGAGAAAAATGCAGTTCCCAATCGGAATTCTGCACGGGGATTTGACGTGGTCGACAACATAAAGTCGGCAGTGGAGAACGTGT
GCCCCGGTGTGGTGTCATGCGCTGATATATTGGCCATTGCTTCCAGAGACTCTGTTGCCATC
GTAAGTTAAACTAATTTATTACCTACTCAATAATTCACGGTCCAATTAGTTAACTTAA
TTAATTACGTTTTTGTTTTTGATATGTGAATTAATGTAGCTTGGAGGACCAAGTTGGAACGTGAAAGTGGGAAGAAGAGACGCAAGAACTGCAAGCCAGGCCGCTGCTAATAACGGCATC
CCCCCTCCAACCTCGAACCTAAACCAGCTGATCTCTAGATTCAATGCTCTTGGCCTTTCCACCAGGGACTTGGTTGCTTTATCTG
GTGATTATATTTTTCTGATGCACACCCTAGACTTG
TTTATGGACACCAATTAATTATTTTAAGGTTAAAAATCACTTTTCGCCTCGATAGTTTGTCAAAGTTTCCATTTTTGTCTTATGCTTTTAATTATGTCAATTTGACCCATACAGTATTAT
ATCTTTACAATTCAAGGATACGTCCAATTTCATGACAGAATAAAAAAGTGAAGAGAAAAAATTAACAGAATTAAAATTACGAAGACCAAAAATAACTTTGTCTTTCTTTAATCAAGTGTT
ACGAGTTCTAACTATTTTATTTGGGCTTGTAAAATTTGTCAGGATCGCATACAATTGGGCAATCAAGGTGCATACAATTCAGGCCCCGCATATACAATGAGACCAATTTGGATAGCTCCT
TCGCCCAAACAAGGCGATCAAACTGCCCAAGAGCCGCTGGCTCAGGGGACAACAACTTGGCCCCACTTGATCTTCAAACCCCTACTGCCTTTGACAACAACTACTTCAAGAACCTCATCC
AGAACAAAGGCCTCCTCCACTCTGATCAGCAGTTGTTCAATGGTGGGTCCACTGATTCCATAGTGCGCACCTACAGCAACAGCTACAACACCTTCAGTTCTGACTTTGTGAGCGCCATCA
TCAAGATGGGAGATATCAAACCTCTCACTGGATCCAATGGGGAGATTAGGAAGAATTGCAGGAAGCCCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCTTCTTTCATGGCCATTTTGACCTTGGCTCTCCTTCTGCAAACGGCCACTTCAAATGCTCAACTTTCAACAAATTTCTACTCTAGCTCTTGCCCGAGGGTCTTCTCCACT
GTGAGATCCACAGTGCAATCCGCTATACGAAAGGAGGCCCGAATTGGGGCCTCCCTTCTCCGCCTCCACTTCCACGACTGTTTCGTTAAT
GGATGCGATGGCTCCTTGCTCCTCGACGAC
ACGTCGAGCTTCACTGGAGAGAAAAATGCAGTTCCCAATCGGAATTCTGCACGGGGATTTGACGTGGTCGACAACATAAAGTCGGCAGTGGAGAACGTGTGCCCCGGTGTGGTGTCATGC
GCTGATATATTGGCCATTGCTTCCAGAGACTCTGTTGCCATC
CTTGGAGGACCAAGTTGGAACGTGAAAGTGGGAAGAAGAGACGCAAGAACTGCAAGCCAGGCCGCTGCTAATAACGGC
ATCCCCCCTCCAACCTCGAACCTAAACCAGCTGATCTCTAGATTCAATGCTCTTGGCCTTTCCACCAGGGACTTGGTTGCTTTATCTG
GATCGCATACAATTGGGCAATCAAGGTGCATA
CAATTCAGGCCCCGCATATACAATGAGACCAATTTGGATAGCTCCTTCGCCCAAACAAGGCGATCAAACTGCCCAAGAGCCGCTGGCTCAGGGGACAACAACTTGGCCCCACTTGATCTT
CAAACCCCTACTGCCTTTGACAACAACTACTTCAAGAACCTCATCCAGAACAAAGGCCTCCTCCACTCTGATCAGCAGTTGTTCAATGGTGGGTCCACTGATTCCATAGTGCGCACCTAC
AGCAACAGCTACAACACCTTCAGTTCTGACTTTGTGAGCGCCATCATCAAGATGGGAGATATCAAACCTCTCACTGGATCCAATGGGGAGATTAGGAAGAATTGCAGGAAGCCCAATTAA

Retrieve as FASTA