Entry information : PpePrx49 (ppa017551m)
Entry ID 9289
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx49 (ppa017551m)
Name (synonym) PpePrx49 (ppa017551m)
Class Class III peroxidase    [Orthogroup: Prx084]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx49
start..stop
S start..stop
MtPrx18 469 7e-168 43..335 42..333
GmPrx167 462 4e-165 43..335 47..338
GmPrx[P]269 446 9e-159 8..335 7..326
CsaPrx34 442 3e-157 7..335 9..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6902064..6902324 261 N° 2 6902561..6903310 750  
join(6902064..6902324,6902561..6903310)


exon

Literature and cross-references PpePrx49 (ppa017551m)
DNA ref. Phytozome 12:   scaffold_4 (6902064..6903310)
Protein sequence: PpePrx49 (ppa017551m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (317)
PWM (Da):   %s   37049.34 (34991.1) Transmb domain:   %s   i3-25o
PI (pH):   %s   9.34 (9.33) Peptide Signal:   %s   cut: 20 range:20-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLCISALSVVLVLLFVSAAPQLAAKNVNKPRATVVRAADLLSFDHYLKTCPQAEGIIQQKTGDWIQKDFTLAASIIRLHFHDCAVRGCDASILLNHQGSERRAFASRTLRGFQVIDDIKAELERQCPKIVSCADILTSAARDATIIAGGPFWQVPFGRKDGRISISREADSVPQGHENVTALIEFFQVRGLNMLDLVTLSGAHTIGRSSCSSFKNRLSNFNGTRKPDPSLNSMYLNNFLKKKCQKDLDLIYLDAITPKTFDTQFYSNLHKKLGLLSTDQLLKSDVRTGPFVAALASQPSLFESQFAVSMVKLGNVQVLTRPNEGEIRVNCNFVNA*

Retrieve as FASTA  
Remarks Complete sequence from genomic. In correct prediction from phytozome(Bad prediction at 5' end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTGTGCATTTCTGCATTGTCTGTTGTTCTTGTTCTGTTGTTTGTATCTGCAGCACCGCAATTAGCAGCTAAAAATGTAAACAAGCCCCGGGCCACAGTTGTGCGTGCGGCGGAT
CTTCTGTCTTTCGACCACTATCTTAAAACATGCCCCCAAGCTGAGGGCATCATTCAGCAAAAAACGGGAGACTGGATCCAGAAGGATTTCACTTTGGCTGCTAGCATCATTCGCTTGCAC
TTCCACGACTGCGCTGTGAGA
GTAAGCTCGCATTTGCATTAAACTTTTTCATTTTTTTCTTCTTTCACATTGGAAAAGAACCAGCCTTTAACATATCCTAATCCGAACACATTACTAATT
AGTATTTTTTAATGTCACTTACCATGTTCTAAACCCCGTGACGAAAATTTAGCAGTTAATAGAACAAAGGCTTAGAGCGTATAAAGAAAGAAATCTTTACATGTATTATATGTGATTAAA
AAAACTCTACATTGCAGGGCTGTGATGCATCAATTTTGCTTAACCATCAAGGGAGCGAGAGGAGAGCTTTTGCCAGCAGGACACTCAGAGGTTTTCAAGTAATAGATGACATCAAGGCAG
AGCTTGAGAGGCAATGCCCTAAAATTGTCTCCTGTGCCGACATTCTCACTTCTGCAGCTAGAGATGCCACCATTATAGCTGGAGGTCCATTTTGGCAAGTCCCGTTCGGGCGTAAAGATG
GACGGATTTCAATTTCCAGGGAAGCTGACTCTGTTCCTCAGGGCCATGAAAATGTAACTGCACTGATTGAGTTTTTCCAAGTACGTGGCTTGAACATGCTTGATTTGGTCACCCTTTCAG
GAGCGCACACCATTGGTAGAAGTTCTTGCTCTTCCTTCAAGAACAGGCTCTCAAACTTCAATGGAACCAGAAAGCCTGATCCTTCACTTAATTCCATGTATTTGAACAACTTCTTGAAGA
AGAAATGCCAAAAAGACTTGGACTTGATTTATCTTGATGCCATAACTCCGAAGACATTCGACACGCAGTTCTACTCGAATCTTCACAAGAAGTTGGGGTTGCTATCAACAGATCAGTTGC
TCAAGTCAGATGTAAGAACTGGTCCATTTGTTGCTGCATTGGCATCTCAGCCCTCCCTTTTTGAGAGCCAGTTTGCAGTGTCCATGGTGAAGCTTGGAAATGTCCAAGTTCTTACAAGAC
CAAATGAAGGTGAAATCCGAGTGAACTGCAATTTTGTCAATGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTGTGCATTTCTGCATTGTCTGTTGTTCTTGTTCTGTTGTTTGTATCTGCAGCACCGCAATTAGCAGCTAAAAATGTAAACAAGCCCCGGGCCACAGTTGTGCGTGCGGCGGAT
CTTCTGTCTTTCGACCACTATCTTAAAACATGCCCCCAAGCTGAGGGCATCATTCAGCAAAAAACGGGAGACTGGATCCAGAAGGATTTCACTTTGGCTGCTAGCATCATTCGCTTGCAC
TTCCACGACTGCGCTGTGAGA
GGCTGTGATGCATCAATTTTGCTTAACCATCAAGGGAGCGAGAGGAGAGCTTTTGCCAGCAGGACACTCAGAGGTTTTCAAGTAATAGATGACATCAAG
GCAGAGCTTGAGAGGCAATGCCCTAAAATTGTCTCCTGTGCCGACATTCTCACTTCTGCAGCTAGAGATGCCACCATTATAGCTGGAGGTCCATTTTGGCAAGTCCCGTTCGGGCGTAAA
GATGGACGGATTTCAATTTCCAGGGAAGCTGACTCTGTTCCTCAGGGCCATGAAAATGTAACTGCACTGATTGAGTTTTTCCAAGTACGTGGCTTGAACATGCTTGATTTGGTCACCCTT
TCAGGAGCGCACACCATTGGTAGAAGTTCTTGCTCTTCCTTCAAGAACAGGCTCTCAAACTTCAATGGAACCAGAAAGCCTGATCCTTCACTTAATTCCATGTATTTGAACAACTTCTTG
AAGAAGAAATGCCAAAAAGACTTGGACTTGATTTATCTTGATGCCATAACTCCGAAGACATTCGACACGCAGTTCTACTCGAATCTTCACAAGAAGTTGGGGTTGCTATCAACAGATCAG
TTGCTCAAGTCAGATGTAAGAACTGGTCCATTTGTTGCTGCATTGGCATCTCAGCCCTCCCTTTTTGAGAGCCAGTTTGCAGTGTCCATGGTGAAGCTTGGAAATGTCCAAGTTCTTACA
AGACCAAATGAAGGTGAAATCCGAGTGAACTGCAATTTTGTCAATGCTTGA

Retrieve as FASTA