Entry information : PpePrx55 (ppa018900m)
Entry ID 9295
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx55 (ppa018900m)
Name (synonym) PpePrx55 (ppa018900m)
Class Class III peroxidase    [Orthogroup: Prx201]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx55
start..stop
S start..stop
PpePrx57 588 0 1..330 1..330
PpePrx53 580 0 1..330 1..329
PpePrx54 466 5e-167 11..330 7..322
PpePrx43 460 1e-164 19..330 13..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1962800..1963036 237 N° 2 1962215..1962409 195 N° 3 1961436..1961996 561  
complement(join(1961436..1961996,1962215..1962409,1962800..1963036))


exon

Literature and cross-references PpePrx55 (ppa018900m)
DNA ref. Phytozome 12:   scaffold_6 (1963036..1961436)
Protein sequence: PpePrx55 (ppa018900m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   35823.8 Transmb domain:   %s   i9-31o
PI (pH):   %s   6.23
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAINCHQCIYVFVTTFFVAAAIVLVPTTCTAQLTSDFYKQSCPQALQIIRSVVKRAINREARMGASLLRLHFHDCFVNGCDGSILLDDADSFTGEKTAGPNLNSVRGFDVVDDIKAALNRDCHGNVVSCADILAVAARDSVEILGGPSYSYEVLLGRRDATTAVLNDANRNLPAPFFAFSQLLSSFQSHGLDLQDLILLSGGHTIGLARCTTFRARIYNDTNIDPEFAASLQKGCPANGGDNNTAPIDSTTTHFDTVYFKSLLQKKGLFHSDQELFKSDGSDSDNLVQHYANSPQDFKVDFGASMVKMGNIKPLTGSDGEIRLNCRKIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Bad prediction at 5' end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAATTAATTGTCATCAATGTATCTATGTTTTTGTCACTACTTTTTTTGTTGCAGCTGCTATTGTGTTGGTCCCAACTACATGCACTGCGCAACTCACTTCTGATTTCTATAAG
CAGTCCTGCCCTCAGGCATTGCAGATCATCAGATCAGTAGTCAAGCGAGCTATTAACCGGGAGGCACGCATGGGAGCGTCGCTTCTACGCTTGCACTTCCATGACTGCTTTGTCAAT
GTA
GGTTTCATTTTGTGGTTGTGTTCAATATCTTCTTTTTTTGTTATTTCTTGTATACAAACAGAGCCATACTTTTTCTCAAGGTAGCGGGATATCGTCTGTTGTCAGACTGTGAATCTGAAG
CATTGATCCTATGAATACTTATTTGAATGAGTGTTACAAAACCAAACACCTTTAGAGTGTGTGTGGTTGAGTTTCACCTCTGTATGGACAAGGAAAAAAGATCACTTGAGATTTGGAAAC
TGTACAGTTTTTACCTAACAAAAAGGAGATAGTTGTTTGACATTAATCATCTTGGATTATTTGTATTAATACTTATGTTTAAAAAATCGTGAAGATTTTAATACTAAGACATATTGATTA
GTTTGAATTTTTCCATCTTGGTGACAGGGGTGTGATGGATCAATTTTGCTCGACGATGCGGATAGCTTCACTGGTGAGAAGACGGCTGGTCCAAATCTGAACTCGGTTAGAGGTTTTGAT
GTGGTTGATGACATTAAAGCAGCCCTCAATAGAGATTGCCATGGCAATGTGGTATCATGTGCAGACATCTTAGCAGTTGCAGCTCGTGACTCGGTTGAGATT
GTAAGTGTTAAAAAAAAG
CCTTCAATGTCAAAATTGTCTAAAAGGCTTTTTAGCCATTTTATATTTGACATGTTATGTTGTTGGACTCTCAATTTGAACCATGCATTTAAATAATAATACACTTGATCAATCATCCAA
TTTCATAGCCTGGCACCATAATAACAACTTAGCCTAGTTAAAACTTGGTAAATTAATCCAATTCTTGTGCTTGTGTTTAGTTGGGAGGTCCTTCTTATTCCTATGAAGTACTATTGGGTA
GAAGAGATGCAACAACTGCAGTCTTGAATGATGCAAACAGAAATCTTCCTGCTCCATTTTTCGCCTTCTCTCAGCTTCTCTCCAGCTTTCAGTCTCATGGTCTAGACCTGCAAGATCTGA
TCCTCCTCTCAGGGGGCCACACCATTGGACTAGCTAGGTGCACCACTTTCAGAGCCAGGATTTACAATGACACCAATATAGACCCTGAGTTTGCAGCCTCCTTGCAAAAAGGTTGTCCTG
CAAATGGTGGAGACAACAACACTGCGCCAATAGACTCAACTACGACGCATTTTGATACCGTGTACTTCAAGTCTTTGCTGCAGAAAAAAGGTCTCTTCCATTCTGATCAGGAGCTCTTTA
AAAGTGATGGCAGTGATAGCGATAATCTGGTGCAGCATTATGCTAATAGCCCCCAGGATTTCAAAGTAGATTTTGGGGCTTCCATGGTCAAGATGGGTAACATAAAGCCTCTCACTGGAT
CTGATGGTGAGATAAGGCTCAATTGCAGGAAAATCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAATTAATTGTCATCAATGTATCTATGTTTTTGTCACTACTTTTTTTGTTGCAGCTGCTATTGTGTTGGTCCCAACTACATGCACTGCGCAACTCACTTCTGATTTCTATAAG
CAGTCCTGCCCTCAGGCATTGCAGATCATCAGATCAGTAGTCAAGCGAGCTATTAACCGGGAGGCACGCATGGGAGCGTCGCTTCTACGCTTGCACTTCCATGACTGCTTTGTCAAT
GGG
TGTGATGGATCAATTTTGCTCGACGATGCGGATAGCTTCACTGGTGAGAAGACGGCTGGTCCAAATCTGAACTCGGTTAGAGGTTTTGATGTGGTTGATGACATTAAAGCAGCCCTCAAT
AGAGATTGCCATGGCAATGTGGTATCATGTGCAGACATCTTAGCAGTTGCAGCTCGTGACTCGGTTGAGATT
TTGGGAGGTCCTTCTTATTCCTATGAAGTACTATTGGGTAGAAGAGAT
GCAACAACTGCAGTCTTGAATGATGCAAACAGAAATCTTCCTGCTCCATTTTTCGCCTTCTCTCAGCTTCTCTCCAGCTTTCAGTCTCATGGTCTAGACCTGCAAGATCTGATCCTCCTC
TCAGGGGGCCACACCATTGGACTAGCTAGGTGCACCACTTTCAGAGCCAGGATTTACAATGACACCAATATAGACCCTGAGTTTGCAGCCTCCTTGCAAAAAGGTTGTCCTGCAAATGGT
GGAGACAACAACACTGCGCCAATAGACTCAACTACGACGCATTTTGATACCGTGTACTTCAAGTCTTTGCTGCAGAAAAAAGGTCTCTTCCATTCTGATCAGGAGCTCTTTAAAAGTGAT
GGCAGTGATAGCGATAATCTGGTGCAGCATTATGCTAATAGCCCCCAGGATTTCAAAGTAGATTTTGGGGCTTCCATGGTCAAGATGGGTAACATAAAGCCTCTCACTGGATCTGATGGT
GAGATAAGGCTCAATTGCAGGAAAATCAACTAA

Retrieve as FASTA