Entry information : PpePrx59 (ppa020254m)
Entry ID 9299
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-08 (Christophe Dunand)
Peroxidase information: PpePrx59 (ppa020254m)
Name (synonym) PpePrx59 (ppa020254m)
Class Class III peroxidase     [Orthogroup: Prx008]*
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx59
start..stop
S start..stop
PtPrx68 424 2e-150 1..323 1..322
MePrx27 423 6e-150 14..323 16..326
PbPrx68 422 8e-150 1..323 1..322
CclPrx47 422 1e-149 10..323 7..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23458329..23458550 222 N° 2 23458660..23458851 192 N° 3 23458927..23459092 166 N° 4 23459239..23459636 398
join(23458329..23458550,23458660..23458851,23458927..23459092,23459239..23459636 )


exon

Literature and cross-references PpePrx59 (ppa020254m)
DNA ref. Phytozome 12:   scaffold_2 (23458329..23459636)
Protein sequence: PpePrx59 (ppa020254m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (301)
PWM (Da):   %s   35606.46 (32973.1)  
PI (pH):   %s   9.38 (9.41) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSYASTAIFLTLALLIVHMEAKAIDEMSPSFYATSCPKLFPTVKPIVESAIKKEARMGASLLRLFYHDCFVNGCDASLLLDNAPNFIGEKNIPPNKNSTRGYEVIDEIKSAVEKKCPGVVSCADIIAIVARDSVSILGGPSWGVQLGRRDARATNAIVTNVSLPLPKANLKELVLRFRGIALKRRDLVALVGAHTPGEAQCHSFRERIYNESNMNKELAQKRRLKCPRSQGSGDANLAPIDAQTPIVFDNSYYKNLVQNKGLLHSDQQLFSGGKTDPIVRTYSKDQEAFFNDFASAMIKMGSVNPLIGPAGEIRLNCRRMNPI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCTTATGCCTCAACAGCCATTTTCTTGACCTTGGCTCTCCTAATTGTGCACATGGAAGCCAAGGCCATCGATGAAATGTCACCAAGTTTTTATGCCACTTCTTGTCCAAAA
CTCTTCCCCACTGTGAAACCCATAGTTGAATCCGCCATTAAAAAGGAGGCTCGAATGGGAGCCTCTCTCCTCCGCCTCTTCTACCATGACTGTTTTGTTAAC
GTAAATTCACCTTCTCCT
TCATCTTTATGCATGCAACTTAGAAATTTGTCATTTGTGACATGGTTTTTTTGTTAATTTGGGTGGTCTTAGAAATATTATGGGTGTGCAGGGATGTGATGCGTCGTTGCTGCTGGATAA
TGCACCAAACTTCATTGGAGAGAAAAATATACCTCCCAATAAGAATTCTACGAGGGGGTATGAAGTGATTGATGAAATCAAGTCTGCGGTGGAGAAAAAGTGCCCTGGCGTCGTCTCATG
TGCTGATATTATTGCCATTGTTGCCAGAGACTCTGTTTCAATT
GTTAGTTAATTAATCACTTGCTTACTACTTGATTAATTCCATAATCAACTTCATAATTCACACCTAATGATGCAGCT
TGGAGGACCAAGTTGGGGTGTTCAATTGGGAAGGAGAGACGCTAGGGCTACGAACGCGATCGTTACTAATGTCAGCTTACCCCTTCCGAAAGCCAATTTAAAGGAGCTCGTCCTTAGATT
CCGTGGTATTGCGCTTAAAAGGAGAGACTTGGTTGCTTTAGTAG
GTATTACTAGCATGTTACGTTTTTAAGTTATCAATACTGGGACTCTTAGTCGAATGTCGTAATAAATTAACATTTT
GTCTTATGTCTACTAATCCATTTTAATATGCGGTTTTTTTTTGTTGGTAAAATTAATATTTACCTGCCAGGAGCTCATACACCTGGAGAAGCACAATGTCACTCCTTCAGAGAGCGCATA
TACAATGAGAGCAACATGAACAAAGAGCTTGCCCAGAAAAGGAGATTAAAATGCCCAAGATCACAAGGCTCGGGTGACGCCAACTTGGCTCCAATTGATGCTCAAACCCCAATAGTGTTT
GACAACAGCTACTACAAAAACCTTGTCCAGAATAAAGGGCTCCTCCACTCTGATCAGCAGCTCTTCAGTGGAGGCAAAACTGATCCCATAGTGCGCACCTACAGTAAAGACCAAGAAGCC
TTCTTTAACGACTTTGCGTCTGCCATGATCAAGATGGGAAGCGTCAACCCCCTCATTGGTCCAGCTGGCGAGATCAGGTTGAATTGCAGGAGGATGAATCCAATAATT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCTTATGCCTCAACAGCCATTTTCTTGACCTTGGCTCTCCTAATTGTGCACATGGAAGCCAAGGCCATCGATGAAATGTCACCAAGTTTTTATGCCACTTCTTGTCCAAAA
CTCTTCCCCACTGTGAAACCCATAGTTGAATCCGCCATTAAAAAGGAGGCTCGAATGGGAGCCTCTCTCCTCCGCCTCTTCTACCATGACTGTTTTGTTAAC
GGATGTGATGCGTCGTTG
CTGCTGGATAATGCACCAAACTTCATTGGAGAGAAAAATATACCTCCCAATAAGAATTCTACGAGGGGGTATGAAGTGATTGATGAAATCAAGTCTGCGGTGGAGAAAAAGTGCCCTGGC
GTCGTCTCATGTGCTGATATTATTGCCATTGTTGCCAGAGACTCTGTTTCAATT
CTTGGAGGACCAAGTTGGGGTGTTCAATTGGGAAGGAGAGACGCTAGGGCTACGAACGCGATCGTT
ACTAATGTCAGCTTACCCCTTCCGAAAGCCAATTTAAAGGAGCTCGTCCTTAGATTCCGTGGTATTGCGCTTAAAAGGAGAGACTTGGTTGCTTTAGTAG
GAGCTCATACACCTGGAGAA
GCACAATGTCACTCCTTCAGAGAGCGCATATACAATGAGAGCAACATGAACAAAGAGCTTGCCCAGAAAAGGAGATTAAAATGCCCAAGATCACAAGGCTCGGGTGACGCCAACTTGGCT
CCAATTGATGCTCAAACCCCAATAGTGTTTGACAACAGCTACTACAAAAACCTTGTCCAGAATAAAGGGCTCCTCCACTCTGATCAGCAGCTCTTCAGTGGAGGCAAAACTGATCCCATA
GTGCGCACCTACAGTAAAGACCAAGAAGCCTTCTTTAACGACTTTGCGTCTGCCATGATCAAGATGGGAAGCGTCAACCCCCTCATTGGTCCAGCTGGCGAGATCAGGTTGAATTGCAGG
AGGATGAATCCAATAATT

Retrieve as FASTA