Entry information : PpePrx61 (ppa020902m)
Entry ID 9301
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-08 (Christophe Dunand)
Peroxidase information: PpePrx61 (ppa020902m)
Name (synonym) PpePrx61 (ppa020902m)
Class Class III peroxidase     [Orthogroup: Prx010]*
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx61
start..stop
S start..stop
PpePrx22 462 2e-165 1..326 1..324
EcamPrx24 440 8e-157 1..326 1..319
EgrPrx23 437 1e-155 27..326 21..319
EcamPrx23 437 1e-155 27..326 21..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24915437..24915670 234 N° 2 24914911..24915102 192 N° 3 24914657..24914819 163 N° 4 24914180..24914568 389
complement(join(24914180..24914568,24914657..24914819,24914911..24915102,2491543 7..24915670))


exon

Literature and cross-references PpePrx61 (ppa020902m)
DNA ref. Phytozome 12:   scaffold_6 (24915670..24914180)
Protein sequence: PpePrx61 (ppa020902m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (300)
PWM (Da):   %s   34398.09 (31654.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.28 (6.88) Peptide Signal:   %s   cut: 27 range:27-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGCYQAFSFKLSFSLVLLLIVGVGLGGVASAELSASFYDKNCPNALSTIKSAVDSAVYKEARMGASLLRLHFHDCFVNGCDASLLLDDTATFKGEKTSVANANSLRGFEVIDNIKAELESLCPNMVSCADILAVAARDSIVALGGPTYTVALGRRDSTAANVTATEDLPSPFVNVTKLIAAFSKKGFTVKEMVALSGAHTIGQARCAFFRGRLYNDTDINASFAAAVRAKCPGSGGSGDNNMSELDVTTPTTFDSSYFKNVMSQKGLLHSDQQLYSGGFTKTAVDAYANNAASFMEDFAEAMNKMGRLSPLTGSIGQIRTNCRKV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTGCTACCAAGCCTTCTCCTTCAAACTCTCCTTTTCACTTGTTCTTCTCCTCATTGTTGGTGTTGGACTTGGAGGAGTAGCTTCTGCTGAGTTATCCGCTAGTTTTTATGACAAA
AACTGCCCCAATGCCCTGTCCACAATCAAATCTGCAGTGGACTCAGCGGTGTACAAAGAAGCTCGCATGGGAGCTTCCTTGCTCCGTCTGCATTTCCACGATTGTTTTGTTAAC
GTAAGC
TCTCGATCGATAGTATTGTTCTAATCTAGAGTAATTTAAATGTTAAGTCTTAGTTACACAACTTGGCATTCGCTTGTCGACATGCGAAATAGTTTGGAACCCTTTCTCGTCTCTGTTTCT
TTTACTTTTCAAGTACATTCAATTCATCTATCTGCTTTGACCCTTACTTTCAGTTTCAGACACGTTTAGTAAATTAGGACTAGTTTATTTTTGTGCAAAATCTGTTTATTGACATGATGA
CATATTAATACTATGAAATACATGCATGCATTATGCATATGTACTTTTTTCTTTTTTATACGTAACCAGTTTGATTATTGAATGACAGGGATGTGATGCATCGTTGCTTTTGGACGACAC
GGCAACCTTTAAAGGAGAGAAAACGTCGGTGGCCAATGCCAATTCTCTCAGAGGATTTGAGGTAATCGACAATATCAAAGCTGAATTGGAGAGCCTCTGCCCCAACATGGTCTCCTGTGC
TGACATCCTGGCCGTTGCTGCCAGGGATTCCATTGTTGCA
GTAAGCCGCCAACAATCTCCTTCAATTCCTATAATTGGCTTCATAATAATCTCCTCTTCTCTTCTAATCTCTTCCATTCT
GTTATAATCAGCTGGGTGGACCCACTTACACAGTGGCATTGGGCAGAAGAGACTCCACCGCTGCAAACGTGACCGCAACGGAGGACCTCCCCAGCCCCTTCGTCAATGTGACCAAGCTAA
TTGCGGCTTTCTCTAAAAAGGGTTTCACCGTGAAAGAAATGGTGGCTCTTTCAG
GTATAGCCTCTGTCATGCTTCATGCCTTTAATTAATTTAATTAGCAAACCAATCTCTCTAACTGTT
TGGTTTTTTCTTGTTTGCTTAGGTGCTCACACTATAGGACAAGCGAGGTGTGCATTCTTCCGTGGACGGCTTTACAACGACACCGACATCAACGCTTCGTTTGCAGCAGCTGTGAGAGCA
AAGTGCCCAGGCAGTGGTGGCTCAGGCGACAACAATATGTCTGAGCTTGACGTCACAACCCCGACCACGTTCGACAGTTCCTACTTCAAGAATGTGATGAGCCAGAAGGGGCTGCTGCAC
TCAGACCAGCAGCTATACAGTGGTGGGTTCACAAAGACCGCGGTGGATGCGTATGCCAATAATGCTGCCAGTTTTATGGAAGACTTTGCCGAAGCGATGAACAAGATGGGACGCCTTAGC
CCTCTGACGGGCTCCATTGGTCAAATTAGAACAAACTGTCGAAAGGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTGCTACCAAGCCTTCTCCTTCAAACTCTCCTTTTCACTTGTTCTTCTCCTCATTGTTGGTGTTGGACTTGGAGGAGTAGCTTCTGCTGAGTTATCCGCTAGTTTTTATGACAAA
AACTGCCCCAATGCCCTGTCCACAATCAAATCTGCAGTGGACTCAGCGGTGTACAAAGAAGCTCGCATGGGAGCTTCCTTGCTCCGTCTGCATTTCCACGATTGTTTTGTTAAC
GGATGT
GATGCATCGTTGCTTTTGGACGACACGGCAACCTTTAAAGGAGAGAAAACGTCGGTGGCCAATGCCAATTCTCTCAGAGGATTTGAGGTAATCGACAATATCAAAGCTGAATTGGAGAGC
CTCTGCCCCAACATGGTCTCCTGTGCTGACATCCTGGCCGTTGCTGCCAGGGATTCCATTGTTGCA
CTGGGTGGACCCACTTACACAGTGGCATTGGGCAGAAGAGACTCCACCGCTGCA
AACGTGACCGCAACGGAGGACCTCCCCAGCCCCTTCGTCAATGTGACCAAGCTAATTGCGGCTTTCTCTAAAAAGGGTTTCACCGTGAAAGAAATGGTGGCTCTTTCAG
GTGCTCACACT
ATAGGACAAGCGAGGTGTGCATTCTTCCGTGGACGGCTTTACAACGACACCGACATCAACGCTTCGTTTGCAGCAGCTGTGAGAGCAAAGTGCCCAGGCAGTGGTGGCTCAGGCGACAAC
AATATGTCTGAGCTTGACGTCACAACCCCGACCACGTTCGACAGTTCCTACTTCAAGAATGTGATGAGCCAGAAGGGGCTGCTGCACTCAGACCAGCAGCTATACAGTGGTGGGTTCACA
AAGACCGCGGTGGATGCGTATGCCAATAATGCTGCCAGTTTTATGGAAGACTTTGCCGAAGCGATGAACAAGATGGGACGCCTTAGCCCTCTGACGGGCTCCATTGGTCAAATTAGAACA
AACTGTCGAAAGGTCAAC

Retrieve as FASTA