Entry information : PpePrx66 (ppa022386m)
Entry ID 9306
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-11-25 (Qiang LI)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx66 (ppa022386m)
Name (synonym) PpePrx66 (ppa022386m)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx66
start..stop
S start..stop
PtPrx08 528 0 25..327 29..331
PtrePrx03 527 0 25..327 28..330
MePrx06 517 0 25..327 28..330
VvPrx38 508 0 25..325 27..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22018684..22018905 222 N° 2 22019018..22019206 189 N° 3 22019987..22020152 166 N° 4 22020806..22021209 404
join(22018684..22018905,22019018..22019206,22019987..22020152,22020806..22021209 )


exon

Literature and cross-references PpePrx66 (ppa022386m)
DNA ref. Phytozome 11:   scaffold_6 (22018684..22021209)
Protein sequence: PpePrx66 (ppa022386m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   36559.26  
PI (pH):   %s   5.26
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKLLCRNLIIYVENVICFNLIGIGKSELQLNYYSESCPKAEEIIKQEVTKLYYEHGNTAVSWLRNLFHDCFVQGCDASLLLESVNGIESEKESGRSFGMRNFKYVNTIKKALENECPSTVSCADVVALSARDGIVMLGGPHIEMKTGRRDSKESYAKIVEEFIPNHNDSLSSVLSRFQSVGIDVEGTVALLGAHSVGRVHCVNLVHRLYPTVDPTLDPDYAEYLKGRCPTPIPDPKAVQYSRNDRETPMILDNNYYKNLLKNKGLLIVDQELASDPATLPFVQKMASDNDYFNEQFSRAALLLSEYNPLSGDQGEVRKDCQYVNT

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAGTTATTATGCCGTAACCTAATTATTTACGTTGAAAATGTTATATGTTTTAATTTGATTGGCATAGGTAAAAGTGAGCTCCAACTAAACTATTACTCCGAGAGTTGCCCAAAA
GCTGAAGAAATAATCAAGCAAGAGGTCACCAAGCTATACTATGAACATGGAAATACAGCCGTCTCTTGGCTTAGAAATCTCTTCCATGATTGCTTCGTTCAG
GTATGAGTTGTGCCTTTG
ACTTTGAGACCTAATTAGTCAATTTATTATTAGGTAAAAATGAGATCAAATAAAAAGATTATACTTTAATTAATTTGTGGCTATATATATGTAGGGATGTGATGCATCTTTATTGTTAGA
GAGTGTGAATGGGATAGAGTCAGAGAAGGAATCTGGAAGGAGCTTTGGGATGAGAAATTTTAAGTACGTGAACACAATCAAAAAGGCTCTTGAGAATGAATGCCCCTCCACAGTTTCTTG
TGCTGATGTTGTTGCTCTTTCTGCGAGAGATGGCATTGTCATG
GTATGTATAGTAATATATATGCATGCGTTTCATTCTCCCTAACTTTTGTTCTCTCTCTTTTTATTTACGATACTTTG
TTATAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTGTTTTTATTGACTGTTTCTATAAAAAGTAATTCTACTCATAATCGTTTTTATTAGAGCACGTTGAAAGTATTTCCTAAAAAA
GAAATACTTAGCATGTGCTTCTTTCAAAAAATGCTTTTATGAGTACTTTAAAATTTTTGCGTTAAACGTTGTCAAGAAGCGCTTTCAACTCTTTGTAACCGGATAGCTAGGTGNNNNNNN
NNNNNNNNNNNNNNNNNNNCCAATAGATCTCCACTTGAGGTTTTGTTAATTAAAGAGAGAGGTTAAGACAAATAAATGGTGTGAACATGATAATTAATTGCAGTTAGGAGGGCCGCACAT
TGAGATGAAAACGGGAAGAAGAGACAGCAAGGAGAGTTATGCGAAAATCGTGGAAGAGTTCATTCCTAATCACAATGATTCATTGTCTTCAGTGCTCTCTCGCTTCCAATCCGTTGGCAT
CGATGTTGAAGGAACAGTTGCCCTTTTAG
GTATGTAAATGCATATTGCATTATCTTGGACTTTCTTAATTGTATGCAACTTATTAAATAAACAAATATACATGGGTGGCACTGTAGTGGA
AAAGTTGTCTAAACTCTCTTTTTCACCTTAAGTGCACTCATGTTCGATTCACGTAAGATACAATCATGAGGCAAAGCAACCGAATATAATAATCCCCCTTCCTTTTCCTTTCCAATAAAT
GAAAAAACAAAAAAACAAAAAACAAATATGGAAGACTTTAATTTACTGTTTACATATACAATCCTTCAGAATAGCTTAATGGGTCGGCAAATATCTTATTATATATGAGGAGAGTAGGGG
CCTCAACATGTGCCTAAAATATAATTCACCAATATTTTAGGTCCAAAAGATAAAATGTTGTACAAAATCACACTTCATAGTTAATCATTCTATTGGATTATAATCATAAAATAACTCATT
AATCAAATGGTGATCACTAACCCAATGAGCAAAACATAATTGGGCATTTTCTAATCCGAATTCACTATAAATTCAAAATAAATGTAGCTTACATTACAATTTCGGTTCTTATAGTTTGGG
TGAAGTTCCATATTTTTTTTTTTACATATAGTTTCTATTTTTCCAATTGTAGACCTGTAGTTTACTAATTGTTGTAATTCAGGAGCTCATTCCGTAGGACGAGTCCACTGTGTGAACCTT
GTACACAGACTCTACCCTACCGTCGATCCAACCCTAGATCCCGACTATGCTGAGTACCTCAAAGGCCGGTGCCCAACCCCAATCCCAGACCCAAAAGCAGTCCAATACTCAAGGAACGAT
CGTGAAACGCCCATGATTCTCGACAACAATTACTACAAGAACTTGTTGAAGAACAAGGGTCTGCTCATAGTGGATCAAGAACTGGCTTCTGACCCAGCTACATTGCCGTTTGTGCAAAAG
ATGGCTTCTGATAATGACTACTTCAATGAGCAGTTTTCTAGGGCTGCCCTGCTTTTATCTGAGTACAATCCACTTAGTGGGGACCAAGGAGAAGTTAGAAAGGATTGTCAATATGTAAAT
ACAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCAAGTTATTATGCCGTAACCTAATTATTTACGTTGAAAATGTTATATGTTTTAATTTGATTGGCATAGGTAAAAGTGAGCTCCAACTAAACTATTACTCCGAGAGTTGCCCAAAA
GCTGAAGAAATAATCAAGCAAGAGGTCACCAAGCTATACTATGAACATGGAAATACAGCCGTCTCTTGGCTTAGAAATCTCTTCCATGATTGCTTCGTTCAG
GGATGTGATGCATCTTTA
TTGTTAGAGAGTGTGAATGGGATAGAGTCAGAGAAGGAATCTGGAAGGAGCTTTGGGATGAGAAATTTTAAGTACGTGAACACAATCAAAAAGGCTCTTGAGAATGAATGCCCCTCCACA
GTTTCTTGTGCTGATGTTGTTGCTCTTTCTGCGAGAGATGGCATTGTCATG
TTAGGAGGGCCGCACATTGAGATGAAAACGGGAAGAAGAGACAGCAAGGAGAGTTATGCGAAAATCGTG
GAAGAGTTCATTCCTAATCACAATGATTCATTGTCTTCAGTGCTCTCTCGCTTCCAATCCGTTGGCATCGATGTTGAAGGAACAGTTGCCCTTTTAG
GAGCTCATTCCGTAGGACGAGTC
CACTGTGTGAACCTTGTACACAGACTCTACCCTACCGTCGATCCAACCCTAGATCCCGACTATGCTGAGTACCTCAAAGGCCGGTGCCCAACCCCAATCCCAGACCCAAAAGCAGTCCAA
TACTCAAGGAACGATCGTGAAACGCCCATGATTCTCGACAACAATTACTACAAGAACTTGTTGAAGAACAAGGGTCTGCTCATAGTGGATCAAGAACTGGCTTCTGACCCAGCTACATTG
CCGTTTGTGCAAAAGATGGCTTCTGATAATGACTACTTCAATGAGCAGTTTTCTAGGGCTGCCCTGCTTTTATCTGAGTACAATCCACTTAGTGGGGACCAAGGAGAAGTTAGAAAGGAT
TGTCAATATGTAAATACAAAT

Retrieve as FASTA