Entry information : PpePrx67 (ppa023088m)
Entry ID 9307
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-08 (Christophe Dunand)
Peroxidase information: PpePrx67 (ppa023088m)
Name (synonym) PpePrx67 (ppa023088m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx67
start..stop
S start..stop
EgrPrx82 496 1e-178 1..328 1..327
EgrPrx88 496 1e-178 1..328 1..327
EglPrx82 495 3e-178 1..328 1..327
FaPrx02 494 8e-178 2..328 3..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1248999..1249223 225 N° 2 1249303..1249488 186 N° 3 1249582..1249747 166 N° 4 1249860..1250266 407
join(1248999..1249223,1249303..1249488,1249582..1249747,1249860..1250266)


exon

Literature and cross-references PpePrx67 (ppa023088m)
DNA ref. Phytozome 12:   scaffold_4 (1248999..1250266)
Protein sequence: PpePrx67 (ppa023088m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (302)
PWM (Da):   %s   35397.34 (32436.7) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.42 (9.45) Peptide Signal:   %s   cut: 27 range:27-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSKLFSYLFLQLTFILFVLDLANAQGGLNVGFYAKSCPKAEDIVKKVIFQTISTTPSLAAPLLRMHFHDCFVRGCEGSILLNSSTNQAEKDAIPNLSLRGFQIIDKAKSALEKACPGVVSCADVLAITARDVVSALNGAHWNVETGRRDGRVSNITEAFMNLLPPTANITILKAGFARKGLSAKDLVVLSGGHTIGTSHCTAFSNRLYNFTGKGDTDPTLDPNYIARLKLKCKPNDQKTLVEMDPGSFKTFDQTYFTLVSKRRGLFQSDAALLDDSETKAYVQSHVAAVGKSSFFKDFGVSMVNMGRIGVLTGNAGEIRKVCSKI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTTCAAAGCTTTTCTCATATCTCTTTCTCCAGCTGACCTTTATACTTTTTGTCCTTGACCTTGCAAATGCGCAGGGAGGGCTCAACGTCGGGTTTTATGCAAAGTCATGCCCC
AAAGCTGAGGACATTGTGAAGAAAGTCATCTTTCAAACCATATCAACTACACCTTCACTTGCTGCTCCTTTGTTGAGAATGCATTTTCATGATTGTTTTGTTAGG
GTAAGTATATATAAC
CAAAGAAATAATGTTATCTATTTCTTTCCATGCAACTGATATATATCACTGGTTTTTCCTGCAGGGTTGCGAAGGTTCGATACTATTGAACTCTTCCACCAACCAAGCTGAAAAAGATGC
AATTCCAAACCTAAGTCTACGAGGATTTCAGATCATCGACAAAGCTAAGTCTGCTTTAGAAAAGGCATGCCCTGGAGTGGTTTCATGTGCAGACGTCTTAGCCATAACAGCTAGAGATGT
GGTTTCCGCG
GTACTAAATCATATCATTTTCCCTCCATTACATTCCATTGAATTTGTAAATTTTGCTTTTAAACAGCTAATGTTCATGATGTGATGACCTCAGCTCAATGGAGCACACTG
GAACGTTGAAACAGGACGAAGAGATGGTAGAGTTTCCAATATAACAGAGGCCTTTATGAATCTACTACCACCCACTGCAAACATTACTATATTAAAAGCAGGCTTTGCACGAAAGGGTCT
AAGCGCCAAAGATCTTGTAGTGCTATCAG
GTACCTAAACACCACAACATATATATACGTAAAGTTTCAGTTTTTACTAACTCTATTATGTTTATGAAACAAATTTAATTACGCTCTCCTA
TTATGCATGCACTTATATAAGGCGGGCACACTATTGGGACTTCTCACTGCACTGCCTTCAGCAACCGCCTTTACAACTTCACGGGGAAGGGCGATACTGATCCCACACTGGATCCCAACT
ACATTGCAAGATTGAAGTTGAAATGCAAACCCAATGATCAAAAGACTCTTGTGGAGATGGATCCGGGGAGTTTCAAGACATTCGACCAGACCTATTTCACTCTCGTGTCCAAGAGAAGGG
GTCTCTTCCAATCCGATGCAGCTCTTCTTGATGACAGCGAGACAAAAGCTTACGTTCAAAGTCATGTTGCCGCCGTTGGAAAATCTAGTTTCTTTAAGGATTTCGGTGTTTCCATGGTGA
ACATGGGTAGGATTGGAGTTCTCACCGGTAACGCAGGGGAAATCAGGAAAGTTTGCAGCAAGATTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTTCAAAGCTTTTCTCATATCTCTTTCTCCAGCTGACCTTTATACTTTTTGTCCTTGACCTTGCAAATGCGCAGGGAGGGCTCAACGTCGGGTTTTATGCAAAGTCATGCCCC
AAAGCTGAGGACATTGTGAAGAAAGTCATCTTTCAAACCATATCAACTACACCTTCACTTGCTGCTCCTTTGTTGAGAATGCATTTTCATGATTGTTTTGTTAGG
GGTTGCGAAGGTTCG
ATACTATTGAACTCTTCCACCAACCAAGCTGAAAAAGATGCAATTCCAAACCTAAGTCTACGAGGATTTCAGATCATCGACAAAGCTAAGTCTGCTTTAGAAAAGGCATGCCCTGGAGTG
GTTTCATGTGCAGACGTCTTAGCCATAACAGCTAGAGATGTGGTTTCCGCG
CTCAATGGAGCACACTGGAACGTTGAAACAGGACGAAGAGATGGTAGAGTTTCCAATATAACAGAGGCC
TTTATGAATCTACTACCACCCACTGCAAACATTACTATATTAAAAGCAGGCTTTGCACGAAAGGGTCTAAGCGCCAAAGATCTTGTAGTGCTATCAG
GCGGGCACACTATTGGGACTTCT
CACTGCACTGCCTTCAGCAACCGCCTTTACAACTTCACGGGGAAGGGCGATACTGATCCCACACTGGATCCCAACTACATTGCAAGATTGAAGTTGAAATGCAAACCCAATGATCAAAAG
ACTCTTGTGGAGATGGATCCGGGGAGTTTCAAGACATTCGACCAGACCTATTTCACTCTCGTGTCCAAGAGAAGGGGTCTCTTCCAATCCGATGCAGCTCTTCTTGATGACAGCGAGACA
AAAGCTTACGTTCAAAGTCATGTTGCCGCCGTTGGAAAATCTAGTTTCTTTAAGGATTTCGGTGTTTCCATGGTGAACATGGGTAGGATTGGAGTTCTCACCGGTAACGCAGGGGAAATC
AGGAAAGTTTGCAGCAAGATTAAC

Retrieve as FASTA