Entry information : PpePrx68 (ppa023274m)
Entry ID 9308
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx68 (ppa023274m)
Name (synonym) PpePrx68 (ppa023274m)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx68
start..stop
S start..stop
CclPrx109 455 2e-162 1..326 2..324
EcamPrx62 442 3e-157 5..333 8..332
MePrx79 442 4e-157 7..325 7..323
EguPrx62 437 5e-155 5..326 8..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10440706..10440930 225 N° 2 10441159..10441338 180 N° 3 10441482..10441641 160 N° 4 10441733..10442169 437
join(10440706..10440930,10441159..10441338,10441482..10441641,10441733..10442169 )


exon

Literature and cross-references PpePrx68 (ppa023274m)
DNA ref. Phytozome 12:   scaffold_6 (10440706..10442169)
Protein sequence: PpePrx68 (ppa023274m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (309)
PWM (Da):   %s   35344.05 (32962.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.14 (8.21) Peptide Signal:   %s   cut: 26 range:26-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSTAAVAVVAIGLVFLTFAGQCSGALEVGFYQGKCGRFVDVEGIVAGIVRTKFFRDRTIAAALIRMQFHDCFVNGCDASILLDGSASEKTAPPNLSVRGFDVIDAAKTAVESVCRGVVSCADIIAIATREAVYLSGGGRYNVQTGRRDGLISLAANVDLPAPSISVPDSVAAFARKGLNMTDMVHLLGGHTVGVAHCFLFQDRLYNFQNTGKPDPDMNVALLGRLRRICPQNSAGTNTTNLDQNPQSSFIVDNSFYKEIVARRGILQIDQELALDPTTQATVTALANSGTNSFATKFGQAMVKLGAVEVLTGSQGEIRRSCRAVNKPGFLTF

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Very short 3' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAGCACAGCTGCAGTGGCAGTAGTAGCAATTGGGCTCGTATTTTTGACCTTCGCGGGCCAGTGCTCCGGTGCTCTGGAGGTAGGATTCTACCAGGGAAAATGCGGCCGGTTTGTA
GATGTTGAAGGTATTGTAGCCGGCATAGTCAGGACAAAATTTTTCAGGGATCGGACAATTGCTGCTGCCCTCATCCGCATGCAGTTTCACGATTGCTTTGTCAAT
GTAAGTCTTTCCTTT
CTTAATAGTAAAACTAAGGTTTATACTCTATTTGAATCACATTTACTGATCACGTATGTAATATGTATGGTATCCGTATGGACTCATATGAGGGGGATTCGCTTCTCTTGTGTTGGAAAA
TAACGTGGTTAGTAAATGTGATCCAAATAACAGGATGATCTTTTTCTTTTATTTCCTACTGCATGAGCTAATGCTTTCATATTTTTCGAAAAGGGATGTGATGCATCCATTCTATTAGAT
GGAAGCGCCAGCGAGAAAACTGCTCCTCCAAATCTAAGCGTACGGGGTTTTGATGTCATTGACGCTGCAAAGACTGCCGTGGAAAGTGTATGCCGGGGAGTTGTCTCTTGTGCTGATATC
ATTGCCATTGCTACCAGAGAAGCTGTTTATTTG
GTAAGCAAACCCTATATTTTTCTGTGCAAATTTTGAGTTTGATGGTTTTATATGGAATCTAACATGACTACATCAGCTTCATTAGTA
TAATTAAGCTTATACTGATTAGTTCATGGTGGTGAAATTTGATTATGTACTTTCAGAGCGGAGGAGGGCGATACAATGTTCAAACAGGGAGAAGGGATGGCTTGATATCCCTTGCAGCAA
ATGTTGACCTCCCAGCTCCCTCAATATCAGTGCCTGATTCAGTTGCAGCATTTGCTAGAAAAGGACTCAATATGACTGATATGGTTCATCTTCTTG
GTAAGTTGGTACTAAAAAAATATA
ATTCATCTCTTTTTTTTCTCTTAATATTCTTGTTCTTAAATTTCTGCCCTACTGCTTGATGATGTAGGTGGTCACACTGTTGGAGTGGCACATTGTTTTCTCTTCCAAGATCGGCTTTAC
AATTTCCAGAACACTGGAAAACCTGACCCCGATATGAATGTAGCGTTACTAGGACGGCTGAGACGTATCTGCCCTCAAAACTCAGCAGGCACCAATACTACTAATTTGGACCAGAACCCT
CAAAGTTCGTTTATTGTCGATAACTCGTTCTACAAGGAGATAGTAGCCCGTAGAGGAATTCTTCAAATTGACCAAGAGCTAGCTTTGGACCCCACAACTCAGGCCACAGTGACCGCCTTA
GCGAATAGCGGTACTAACAGCTTCGCCACTAAATTCGGACAGGCCATGGTTAAGTTGGGAGCAGTTGAAGTCCTTACTGGCTCACAAGGGGAGATTAGGAGATCATGCCGGGCAGTTAAT
AAACCTGGTTTTTTAACTTTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAGCACAGCTGCAGTGGCAGTAGTAGCAATTGGGCTCGTATTTTTGACCTTCGCGGGCCAGTGCTCCGGTGCTCTGGAGGTAGGATTCTACCAGGGAAAATGCGGCCGGTTTGTA
GATGTTGAAGGTATTGTAGCCGGCATAGTCAGGACAAAATTTTTCAGGGATCGGACAATTGCTGCTGCCCTCATCCGCATGCAGTTTCACGATTGCTTTGTCAAT
GGATGTGATGCATCC
ATTCTATTAGATGGAAGCGCCAGCGAGAAAACTGCTCCTCCAAATCTAAGCGTACGGGGTTTTGATGTCATTGACGCTGCAAAGACTGCCGTGGAAAGTGTATGCCGGGGAGTTGTCTCT
TGTGCTGATATCATTGCCATTGCTACCAGAGAAGCTGTTTATTTG
AGCGGAGGAGGGCGATACAATGTTCAAACAGGGAGAAGGGATGGCTTGATATCCCTTGCAGCAAATGTTGACCTC
CCAGCTCCCTCAATATCAGTGCCTGATTCAGTTGCAGCATTTGCTAGAAAAGGACTCAATATGACTGATATGGTTCATCTTCTTG
GTGGTCACACTGTTGGAGTGGCACATTGTTTTCTC
TTCCAAGATCGGCTTTACAATTTCCAGAACACTGGAAAACCTGACCCCGATATGAATGTAGCGTTACTAGGACGGCTGAGACGTATCTGCCCTCAAAACTCAGCAGGCACCAATACTACT
AATTTGGACCAGAACCCTCAAAGTTCGTTTATTGTCGATAACTCGTTCTACAAGGAGATAGTAGCCCGTAGAGGAATTCTTCAAATTGACCAAGAGCTAGCTTTGGACCCCACAACTCAG
GCCACAGTGACCGCCTTAGCGAATAGCGGTACTAACAGCTTCGCCACTAAATTCGGACAGGCCATGGTTAAGTTGGGAGCAGTTGAAGTCCTTACTGGCTCACAAGGGGAGATTAGGAGA
TCATGCCGGGCAGTTAATAAACCTGGTTTTTTAACTTTTAAT

Retrieve as FASTA