Entry information : PpePrx70 (ppa023604m)
Entry ID 9310
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-08 (Christophe Dunand)
Peroxidase information: PpePrx70 (ppa023604m)
Name (synonym) PpePrx70 (ppa023604m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx70
start..stop
S start..stop
EgrPrx144 481 3e-173 6..304 29..325
EcamPrx144 479 7e-173 6..304 10..306
EguPrx144 475 6e-171 6..304 29..325
VvPrx32 467 4e-168 6..304 4..302
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31142147..31142308 162 N° 2 31142405..31142596 192 N° 3 31142754..31142919 166 N° 4 31143017..31143408 392
join(31142147..31142308,31142405..31142596,31142754..31142919,31143017..31143408 )


exon

Literature and cross-references PpePrx70 (ppa023604m)
DNA ref. Phytozome 12:   scaffold_1 (31142147..31143408)
Protein sequence: PpePrx70 (ppa023604m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   304
PWM (Da):   %s   32623.3  
PI (pH):   %s   8.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTASQAQLSSTFYDRTCPNALATIKSSISRAVSQERRMAASLMRLHFHDCFVQGCDASLLLNDSASIVSEKNAFQNRGSARGFEVIDDAKAQVEKICPGVVSCADILAVAARDASVAVSGPSWTVKLGRRDATRASQAQAESDLPLFTDSLDRLISRFGDRGLSPRDLVALSGAHTIGQAQCFTFRDRIYNNGSDIDSNFATTRRRRCPAAAPNGNTNLAPLDLVTPNSFDYNYFKNLIQKKGLLESDQVLFSGGSTDSIVSEYSSKPATFRSDFGIAMIKMGDVSPLTGSAGEIRRICTAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCACAGCAAGCCAAGCGCAACTGTCTTCAACATTCTATGACCGAACCTGCCCAAACGCTCTTGCTACTATCAAATCATCCATAAGCAGAGCAGTTTCGCAAGAACGCCGGATGGCG
GCGTCCCTAATGCGCCTCCATTTCCATGATTGCTTTGTTCAG
GTACGTACTAATTACCCCTTCATTAATTAAGCCAGCCACTGATTGATCATAAGCAGTCTTTGACTCTTGGTTTTTGTT
TTTGATGATCGATTGCAGGGTTGTGACGCCTCACTCTTACTTAATGATTCTGCTTCTATCGTAAGCGAAAAGAACGCATTTCAAAACAGGGGTTCTGCTAGAGGCTTCGAAGTCATAGAT
GATGCAAAAGCTCAAGTGGAGAAGATTTGCCCTGGTGTTGTATCTTGCGCAGATATCCTTGCTGTGGCAGCTCGGGATGCATCAGTTGCT
GTGAGTAGATAAATAAATAATATTTCAATT
TGATTCTTTTATTATCTTTATTAATTGGAATTATGGTAATGTCAATCTCGTGGCTTTAATCTTGTACTACTACTATGGTAATAATTGCAATTAACTAANNNNNNNNNNNNNNNNNNNNNN
NNNNNNGGTGAGTGGTCCATCTTGGACTGTGAAGCTTGGAAGAAGAGATGCGACCAGAGCAAGCCAAGCCCAAGCTGAAAGTGACCTTCCACTTTTCACAGACTCCCTTGACCGCCTTAT
TTCCAGATTTGGTGACAGAGGCCTCAGTCCCAGAGATCTGGTTGCGTTGTCAG
GTAACTATTTAAATGAATCATATATGCCTGCCTTGCTTAGAAAATGCTATATTAATTAAAACTTTAT
GCTAATGAACTTATATACGTATGAATGCAGGTGCACATACAATAGGGCAGGCTCAGTGCTTCACATTTCGTGACAGGATTTACAACAATGGAAGTGACATTGATTCTAACTTTGCAACTA
CTCGCAGACGCCGCTGTCCAGCTGCTGCACCCAACGGTAACACCAATTTGGCACCACTTGATTTGGTGACACCAAATTCATTCGACTACAATTACTTCAAGAATTTAATCCAGAAGAAGG
GTCTTCTTGAATCAGATCAAGTTCTCTTTAGTGGAGGATCCACAGACAGCATTGTCTCTGAGTATAGTTCGAAACCCGCAACTTTTAGGTCTGATTTTGGAATCGCCATGATTAAGATGG
GAGACGTTTCTCCTCTCACCGGTTCAGCTGGAGAGATCAGAAGGATTTGCACTGCTGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCACAGCAAGCCAAGCGCAACTGTCTTCAACATTCTATGACCGAACCTGCCCAAACGCTCTTGCTACTATCAAATCATCCATAAGCAGAGCAGTTTCGCAAGAACGCCGGATGGCG
GCGTCCCTAATGCGCCTCCATTTCCATGATTGCTTTGTTCAG
GGTTGTGACGCCTCACTCTTACTTAATGATTCTGCTTCTATCGTAAGCGAAAAGAACGCATTTCAAAACAGGGGTTCT
GCTAGAGGCTTCGAAGTCATAGATGATGCAAAAGCTCAAGTGGAGAAGATTTGCCCTGGTGTTGTATCTTGCGCAGATATCCTTGCTGTGGCAGCTCGGGATGCATCAGTTGCT
GTGAGT
GGTCCATCTTGGACTGTGAAGCTTGGAAGAAGAGATGCGACCAGAGCAAGCCAAGCCCAAGCTGAAAGTGACCTTCCACTTTTCACAGACTCCCTTGACCGCCTTATTTCCAGATTTGGT
GACAGAGGCCTCAGTCCCAGAGATCTGGTTGCGTTGTCAG
GTGCACATACAATAGGGCAGGCTCAGTGCTTCACATTTCGTGACAGGATTTACAACAATGGAAGTGACATTGATTCTAAC
TTTGCAACTACTCGCAGACGCCGCTGTCCAGCTGCTGCACCCAACGGTAACACCAATTTGGCACCACTTGATTTGGTGACACCAAATTCATTCGACTACAATTACTTCAAGAATTTAATC
CAGAAGAAGGGTCTTCTTGAATCAGATCAAGTTCTCTTTAGTGGAGGATCCACAGACAGCATTGTCTCTGAGTATAGTTCGAAACCCGCAACTTTTAGGTCTGATTTTGGAATCGCCATG
ATTAAGATGGGAGACGTTTCTCCTCTCACCGGTTCAGCTGGAGAGATCAGAAGGATTTGCACTGCTGTCAAC

Retrieve as FASTA