Entry information : PpePrx71 (ppa023679m)
Entry ID 9311
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-08 (Christophe Dunand)
Peroxidase information: PpePrx71 (ppa023679m)
Name (synonym) PpePrx71 (ppa023679m)
Class Class III peroxidase    [Orthogroup: Prx038]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx71
start..stop
S start..stop
LjPrx50 507 0 23..351 24..350
GmPrx64 504 0 33..351 24..342
MePrx118 495 1e-177 1..351 1..345
MtPrx100 494 2e-177 30..351 26..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6492200..6492505 306 N° 2 6491560..6491902 343 N° 3 6490941..6491344 404  
complement(join(6490941..6491344,6491560..6491902,6492200..6492505))


exon

Literature and cross-references PpePrx71 (ppa023679m)
DNA ref. Phytozome 12:   scaffold_4 (6492505..6490941)
Protein sequence: PpePrx71 (ppa023679m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (330)
PWM (Da):   %s   38935.44 (36726.2)  
PI (pH):   %s   6.13 (6.13) Peptide Signal:   %s   cut: 22 range:22-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSIVSLLLVLVVVQLNPSSCDPEHDYHKEETHESWEGATTLTLPSLSDDLPFGEFLSSGFYRKSCPDLEGIINRKVKEWLKQDFSLAASLMRLHFHDCAIRGCDASILLYHEGSERTAAASKTLRGFELIDDIKAEVEKKCPKTVSCADILTAATRDATVQAGGPYWAVPYGRRDGKVSIAKETEMVPMGHENITALVEFFQSQGLNVLDLVVLSGAHTIGRSSCGSVQHRLYNFSGTGKPDPSLDPQYLNYLERKCRWASDYVDLDAATPHKFDIGYYTNLQKKMGLLSTDQLLYSDPRTSPLIKAFAYQPSVFYHQFGVSMAKLGNVQVLTEKNEGEIRTNCNFVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCCATAGTTTCCTTGCTCCTTGTTCTTGTTGTTGTGCAGTTAAATCCATCTTCATGTGACCCAGAACATGATTACCATAAAGAAGAAACACATGAGTCTTGGGAGGGAGCCACC
ACTCTAACACTTCCAAGTTTGTCAGACGACTTGCCGTTTGGAGAGTTTCTTTCCTCTGGTTTCTACCGCAAGAGTTGTCCTGACCTTGAAGGCATTATCAATAGGAAGGTCAAGGAATGG
CTTAAGCAGGATTTCAGCCTTGCTGCTAGCCTCATGAGGTTGCATTTCCATGACTGTGCCATCAGG
GTAAGAATATTAACCATGTTATACTTGCACGTACATGTGTACGTCGCACGTGAT
TAATAATAAGTAGTTGGAAAATACTTCATAACTCAACTCTTTTCTCAACTCGTTTAACTAATTACATAAAGTGAGATCTATGATACTGCGATATTATTTCAACGATCCACTTTATGTGAC
AAAGTTGGGAAAAAGAGGAAAATAGTTTGCTTCATTGCTTAACAAACCAATTTCATATAGTAATATTACATGCCTTATATCACAACGTGCCTTATATTCATTTGTGGTTTGCAATATATG
TAGGGATGTGATGCCTCCATCTTATTATACCATGAGGGAAGTGAGAGGACAGCTGCGGCCAGCAAGACACTAAGAGGGTTTGAACTGATAGATGATATTAAAGCAGAGGTTGAGAAGAAG
TGCCCAAAGACAGTATCTTGTGCAGACATTTTGACTGCAGCTACCAGAGATGCTACTGTTCAAGCTGGAGGTCCATACTGGGCCGTCCCCTATGGGAGGAGAGATGGGAAAGTTTCAATT
GCCAAGGAAACTGAAATGGTGCCAATGGGTCACGAAAACATCACTGCTTTGGTTGAGTTTTTCCAATCACAGGGCTTGAATGTACTTGACTTGGTCGTTCTCTCAG
GTGAACCATCTAGT
CCACATGCATCTTGCTCGCATATTATATCGTCACACCGTCAATTTGGGCCGCATGTTCAAACATGAATCAACTTAATTATAGGTCCAAATTGACAGTGTGACAACATAACTAGTGTGTGA
CGACAACAAAAATTTCCTACAACTAGTCACTAGAACACGAATCTAACTGCTTTTGTTGCAATAAATGGTTTTGATCTGCAGGGGCACACACCATAGGAAGGTCTTCATGCGGTTCTGTAC
AACACAGGCTCTATAACTTCAGTGGAACTGGCAAGCCTGATCCATCCCTTGATCCACAGTATTTGAACTACTTGGAAAGAAAATGCAGATGGGCATCGGACTATGTTGATCTTGATGCTG
CAACTCCACATAAATTTGACATTGGATATTACACCAATCTGCAGAAGAAGATGGGACTTTTGTCCACAGACCAACTGTTGTATTCTGATCCAAGGACTTCACCTCTTATCAAGGCTTTTG
CTTACCAGCCATCAGTCTTCTACCACCAGTTTGGAGTGTCCATGGCCAAATTAGGGAATGTTCAAGTCCTCACCGAGAAAAACGAAGGCGAAATTCGAACCAATTGCAATTTTGTCAACT
CTTAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCCATAGTTTCCTTGCTCCTTGTTCTTGTTGTTGTGCAGTTAAATCCATCTTCATGTGACCCAGAACATGATTACCATAAAGAAGAAACACATGAGTCTTGGGAGGGAGCCACC
ACTCTAACACTTCCAAGTTTGTCAGACGACTTGCCGTTTGGAGAGTTTCTTTCCTCTGGTTTCTACCGCAAGAGTTGTCCTGACCTTGAAGGCATTATCAATAGGAAGGTCAAGGAATGG
CTTAAGCAGGATTTCAGCCTTGCTGCTAGCCTCATGAGGTTGCATTTCCATGACTGTGCCATCAGG
GGATGTGATGCCTCCATCTTATTATACCATGAGGGAAGTGAGAGGACAGCTGCG
GCCAGCAAGACACTAAGAGGGTTTGAACTGATAGATGATATTAAAGCAGAGGTTGAGAAGAAGTGCCCAAAGACAGTATCTTGTGCAGACATTTTGACTGCAGCTACCAGAGATGCTACT
GTTCAAGCTGGAGGTCCATACTGGGCCGTCCCCTATGGGAGGAGAGATGGGAAAGTTTCAATTGCCAAGGAAACTGAAATGGTGCCAATGGGTCACGAAAACATCACTGCTTTGGTTGAG
TTTTTCCAATCACAGGGCTTGAATGTACTTGACTTGGTCGTTCTCTCAG
GGGCACACACCATAGGAAGGTCTTCATGCGGTTCTGTACAACACAGGCTCTATAACTTCAGTGGAACTGGC
AAGCCTGATCCATCCCTTGATCCACAGTATTTGAACTACTTGGAAAGAAAATGCAGATGGGCATCGGACTATGTTGATCTTGATGCTGCAACTCCACATAAATTTGACATTGGATATTAC
ACCAATCTGCAGAAGAAGATGGGACTTTTGTCCACAGACCAACTGTTGTATTCTGATCCAAGGACTTCACCTCTTATCAAGGCTTTTGCTTACCAGCCATCAGTCTTCTACCACCAGTTT
GGAGTGTCCATGGCCAAATTAGGGAATGTTCAAGTCCTCACCGAGAAAAACGAAGGCGAAATTCGAACCAATTGCAATTTTGTCAACTCTTAT

Retrieve as FASTA