Entry information : PpePrx74 (ppa024711m)
Entry ID 9314
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2016-01-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-11 (Achraf Jemmat)
Peroxidase information: PpePrx74 (ppa024711m)
Name (synonym) PpePrx74 (ppa024711m)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx74
start..stop
S start..stop
VvPrx54 510 0 1..322 1..322
GmPrx37 501 0 1..323 1..322
CmicPrx01 486 7e-175 5..323 7..325
GmPrx138 484 2e-174 1..323 1..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20858929..20859135 207 N° 2 20858587..20858778 192 N° 3 20858319..20858484 166 N° 4 20857646..20858055 410
complement(join(20857646..20858055,20858319..20858484,20858587..20858778,2085892 9..20859135))


exon

Literature and cross-references PpePrx74 (ppa024711m)
DNA ref. Phytozome 12:   scaffold_8 (20859135..20857649)
Protein sequence: PpePrx74 (ppa024711m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (303)
PWM (Da):   %s   35297.8 (33068.7) Transmb domain:   %s   i5-24o
PI (pH):   %s   8.42 (8.57) Peptide Signal:   %s   cut: 22 range:22-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNVNILLVAFVVCGLLGACQGGQLRKNFYRSTCPSAEEIVRNVTWNHVSSNPNLPAKLLRMHFHDCFVRGCDGSVLLNSTANNTAEKDAAPNLSLAGFNVIDDIKENLENKCPGIVSCADILALAARDSVSFQFKRSLWKVLTGRRDGTISRTREALINIPPPAFNFTQLKQRFASKNLTVHDLVVLSGSHTIGVGHCPTFSNRLYNFTGKGDQDPSLNATYAAFLKTKCPSLNDTTTTVEMDPGSSLKFDTGYYATLKQHKGLFQSDAALLTNKGAANIVQELGDNDKFFAEFAQSMVRMGAIEVLTGTSGEIRSKCWAVNSN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATGTCAATATTCTGTTAGTGGCCTTTGTAGTTTGTGGCCTTCTAGGGGCCTGCCAAGGAGGCCAGCTGAGGAAGAATTTCTACCGGAGCACGTGTCCTTCAGCAGAGGAGATTGTC
AGAAATGTCACCTGGAACCATGTCTCCAGTAACCCCAACTTGCCAGCAAAGCTCTTGAGAATGCATTTCCATGACTGTTTCGTCAGG
GTAAGCCTCAACTGTTTCGTCAGGATAACTATA
TATGCATGGTTGCATGACATGCAACATTTCAATGCTTATACATTGTTCATGTTCATATTGCTTATGATATATATATTCGTCTAACCTTGTTGAAGAATGCATGTGAAATATTTGCAGGGT
TGTGATGGCTCAGTTTTGTTGAATTCGACAGCAAACAACACGGCAGAGAAGGACGCAGCTCCAAACTTATCTTTGGCAGGTTTTAATGTTATTGATGATATCAAAGAAAACCTAGAGAAC
AAGTGTCCAGGAATTGTATCTTGTGCTGACATCTTGGCTTTGGCTGCCAGAGACTCTGTTTCATTCCAA
GTAAGACATTCTTAAGCAAAGCAAAGCCTAAAATTACAATTCATATGTATA
TATATGCTGCAGCATCGCACTCATGTGTTGTATAACTTTTGATATATATAGTTCAAAAGATCGTTGTGGAAAGTGCTCACGGGTAGAAGAGACGGCACAATTTCACGAACTAGAGAGGCC
TTGATCAACATTCCACCACCTGCCTTCAATTTCACCCAACTCAAACAGCGCTTTGCCAGCAAGAATCTTACAGTACATGACCTTGTGGTTTTATCAG
GTATAGTGTACCCCAGAGACGAT
GATAATTAATTATTTTTTCATTATTTTGTCAAAACGATATTCTAAAGTACTTTAGCTAATGTATGGGGAGTGAGATCGAACTCGGATTCAAGAAAATATACACACTGTCTTAGCCAATTG
ACTTAATAATCCACACCTGCTTACACTATAGTCGATTAGCAAATTAATAATTAATTAAAAGCAAACATAAATGGCCAATCTTAATCTTATATATAATATATAAGTATTATTATTGTGTAG

GTTCACACACAATTGGAGTAGGGCACTGCCCCACCTTTAGCAACAGGCTCTACAACTTCACTGGAAAGGGTGACCAAGACCCTTCTCTGAATGCAACCTATGCTGCATTCCTCAAGACTA
AATGCCCAAGCCTCAACGACACTACAACCACTGTGGAAATGGACCCTGGGAGCTCTTTAAAATTTGACACTGGCTACTATGCCACCCTCAAGCAGCACAAGGGACTCTTCCAATCTGATG
CAGCCCTTTTAACAAACAAGGGTGCCGCCAATATCGTCCAGGAATTGGGTGACAATGACAAGTTCTTCGCAGAGTTTGCTCAATCAATGGTGAGGATGGGAGCCATTGAGGTCCTCACAG
GCACGTCCGGTGAGATTAGGAGCAAATGTTGGGCTGTGAATTCCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATGTCAATATTCTGTTAGTGGCCTTTGTAGTTTGTGGCCTTCTAGGGGCCTGCCAAGGAGGCCAGCTGAGGAAGAATTTCTACCGGAGCACGTGTCCTTCAGCAGAGGAGATTGTC
AGAAATGTCACCTGGAACCATGTCTCCAGTAACCCCAACTTGCCAGCAAAGCTCTTGAGAATGCATTTCCATGACTGTTTCGTCAGG
GGTTGTGATGGCTCAGTTTTGTTGAATTCGACA
GCAAACAACACGGCAGAGAAGGACGCAGCTCCAAACTTATCTTTGGCAGGTTTTAATGTTATTGATGATATCAAAGAAAACCTAGAGAACAAGTGTCCAGGAATTGTATCTTGTGCTGAC
ATCTTGGCTTTGGCTGCCAGAGACTCTGTTTCATTCCAA
TTCAAAAGATCGTTGTGGAAAGTGCTCACGGGTAGAAGAGACGGCACAATTTCACGAACTAGAGAGGCCTTGATCAACATT
CCACCACCTGCCTTCAATTTCACCCAACTCAAACAGCGCTTTGCCAGCAAGAATCTTACAGTACATGACCTTGTGGTTTTATCAG
GTTCACACACAATTGGAGTAGGGCACTGCCCCACC
TTTAGCAACAGGCTCTACAACTTCACTGGAAAGGGTGACCAAGACCCTTCTCTGAATGCAACCTATGCTGCATTCCTCAAGACTAAATGCCCAAGCCTCAACGACACTACAACCACTGTG
GAAATGGACCCTGGGAGCTCTTTAAAATTTGACACTGGCTACTATGCCACCCTCAAGCAGCACAAGGGACTCTTCCAATCTGATGCAGCCCTTTTAACAAACAAGGGTGCCGCCAATATC
GTCCAGGAATTGGGTGACAATGACAAGTTCTTCGCAGAGTTTGCTCAATCAATGGTGAGGATGGGAGCCATTGAGGTCCTCACAGGCACGTCCGGTGAGATTAGGAGCAAATGTTGGGCT
GTGAATTCCAATTAA

Retrieve as FASTA