Entry information : PpePrx76 (ppa025451m)
Entry ID 9316
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-16 (Qiang Li)
Peroxidase information: PpePrx76 (ppa025451m)
Name (synonym) PpePrx76 (ppa025451m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpePrx76
start..stop
S start..stop
RcPrx44 501 1e-180 1..328 1..327
EgrPrx73 496 7e-179 1..327 1..325
CsPrx39 495 2e-178 16..328 21..333
EglPrx73 495 2e-178 1..327 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34221281..34221505 225 N° 2 34221676..34221855 180 N° 3 34221971..34222136 166 N° 4 34222279..34222691 413
join(34221281..34221505,34221676..34221855,34221971..34222136,34222279..34222691 )


exon

Literature and cross-references PpePrx76 (ppa025451m)
DNA ref. Phytozome 12:   scaffold_1 (34221281..34222691)
Protein sequence: PpePrx76 (ppa025451m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   35299.54 (32236.1) Transmb domain:   %s   i7-26o
PI (pH):   %s   4.91 (4.71) Peptide Signal:   %s   cut: 28 range:28-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKRPTAFFYTHGVFFVWLCLAASASCDELTLSFYSASCPSAELMVRNTVRSASDIDPTIPGKLLRLLFHDCFVEGCDASVLLQGTGTERSDPANTSLGGFSVIDSAKRLLEIFCPGTVSCADIVALAARDAVEISGGPVVQIPTGRRDGKVSAASNVRPNIVDTSFTMDEMIKLFSSKGLSLDDLVTLSGAHTIGSAHCGAFSDRFQQDSKGKLKLIDTSLDNAYAEELMRQCPAGANPSTTVKIDPNTSFAFDNHYYQNLLAHRGLFQSDSVLLSDDRTRKLVESFAQDQVIFLESWAQSFLKLASIGVKTGEEGEIRASCPTTN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAAAGACCAACAGCCTTCTTTTACACACATGGTGTCTTCTTTGTGTGGTTATGTTTAGCTGCTTCTGCTTCTTGTGATGAGCTCACATTGAGTTTCTACTCAGCTTCATGCCCT
TCTGCTGAGCTCATGGTCAGAAACACAGTCAGATCAGCTTCTGACATAGACCCTACCATCCCTGGGAAGCTTCTTCGCTTGCTCTTCCATGATTGCTTTGTGGAG
GTAAACAACTCTAGC
TTGCTCTCTTAGATGCCTTATGCCTCATTGATTTTCGGCATTGATTTGAATTGACACTAAGCTCCCTCCCCCAAGGAAAAAAAAAATCTTAAACCATGAAAATGGGTGGCTTCTTTCATG
CATGTTTGTTTGTGTAATGTTTTTCATGATTTCAGGGTTGTGATGCATCTGTGCTTCTACAAGGAACTGGGACTGAGAGAAGTGATCCAGCAAACACATCTCTGGGAGGCTTTTCAGTGA
TTGATTCAGCAAAAAGACTGCTTGAAATTTTCTGTCCAGGAACTGTTTCTTGTGCTGACATTGTTGCTTTGGCTGCTAGAGATGCTGTTGAAATT
GTTAAGATCCATCTCCCTCATTAAC
TGTTATGTTTAATTCTTCATTAATTCTTTTTTAATTTTCTGCATCTTCTAGTTGGGTATTTATTATATTTATGGTATGACTGGAAAACAGTCTGGGGGACCTGTAGTTCAGATTCCAACT
GGTAGGAGAGATGGAAAGGTTTCTGCAGCTTCAAATGTCAGGCCTAATATTGTAGACACAAGTTTTACAATGGATGAGATGATTAAGCTCTTCTCATCTAAAGGGTTGTCTTTGGATGAC
CTTGTCACCCTATCAG
GTACAATTTTATTTATCTAGACACGTGTTTTTGCTTGCCAAAAGTTTGATTGAACCACTTTTTTGTTAGTTTAAAAATTTAATGAGAGGTTGAAGTCTTTTAGG
TACACCATTAACTGCTTTCTTTGATGATATTATTCCAGGAGCTCACACTATTGGATCAGCTCATTGTGGCGCATTCAGTGACAGGTTCCAACAAGACTCCAAGGGGAAACTCAAACTCAT
TGACACATCCTTAGACAACGCTTATGCAGAGGAGCTCATGAGACAGTGCCCTGCGGGCGCAAATCCATCTACAACAGTCAAAATTGATCCTAACACTTCGTTTGCGTTCGATAATCATTA
CTACCAAAATCTCTTAGCCCACAGAGGGCTATTTCAATCGGATTCCGTCCTGTTAAGTGATGACAGAACAAGGAAGCTAGTGGAGAGTTTTGCACAGGACCAAGTTATTTTCTTGGAGAG
TTGGGCTCAGTCATTCTTGAAGCTTGCTAGCATTGGCGTCAAGACTGGTGAAGAAGGCGAAATTCGAGCCTCTTGTCCAACAACTAATGCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAAAGACCAACAGCCTTCTTTTACACACATGGTGTCTTCTTTGTGTGGTTATGTTTAGCTGCTTCTGCTTCTTGTGATGAGCTCACATTGAGTTTCTACTCAGCTTCATGCCCT
TCTGCTGAGCTCATGGTCAGAAACACAGTCAGATCAGCTTCTGACATAGACCCTACCATCCCTGGGAAGCTTCTTCGCTTGCTCTTCCATGATTGCTTTGTGGAG
GGTTGTGATGCATCT
GTGCTTCTACAAGGAACTGGGACTGAGAGAAGTGATCCAGCAAACACATCTCTGGGAGGCTTTTCAGTGATTGATTCAGCAAAAAGACTGCTTGAAATTTTCTGTCCAGGAACTGTTTCT
TGTGCTGACATTGTTGCTTTGGCTGCTAGAGATGCTGTTGAAATT
TCTGGGGGACCTGTAGTTCAGATTCCAACTGGTAGGAGAGATGGAAAGGTTTCTGCAGCTTCAAATGTCAGGCCT
AATATTGTAGACACAAGTTTTACAATGGATGAGATGATTAAGCTCTTCTCATCTAAAGGGTTGTCTTTGGATGACCTTGTCACCCTATCAG
GAGCTCACACTATTGGATCAGCTCATTGT
GGCGCATTCAGTGACAGGTTCCAACAAGACTCCAAGGGGAAACTCAAACTCATTGACACATCCTTAGACAACGCTTATGCAGAGGAGCTCATGAGACAGTGCCCTGCGGGCGCAAATCCA
TCTACAACAGTCAAAATTGATCCTAACACTTCGTTTGCGTTCGATAATCATTACTACCAAAATCTCTTAGCCCACAGAGGGCTATTTCAATCGGATTCCGTCCTGTTAAGTGATGACAGA
ACAAGGAAGCTAGTGGAGAGTTTTGCACAGGACCAAGTTATTTTCTTGGAGAGTTGGGCTCAGTCATTCTTGAAGCTTGCTAGCATTGGCGTCAAGACTGGTGAAGAAGGCGAAATTCGA
GCCTCTTGTCCAACAACTAATGCA

Retrieve as FASTA