Entry information : RcAPx02 (29602.m000217)
Entry ID 9328
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-02 (Qiang Li)
Peroxidase information: RcAPx02 (29602.m000217)
Name (synonym) RcAPx02 (29602.m000217)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcAPx02
start..stop
S start..stop
CsAPx03 509 0 1..288 1..287
CclAPx03 508 0 1..288 1..287
GhAPx01 507 0 1..288 1..288
MeAPx08 507 0 1..287 1..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 103512..103624 113 N° 2 103736..103860 125 N° 3 103973..104022 50 N° 4 104596..104661 66
N° 5 104739..104787 49 N° 6 112526..112608 83 N° 7 112696..112775 80 N° 8 112870..112972 103
N° 9 113665..113862 198  
join(103512..103624,103736..103860,103973..104022,104596..104661,104739..104787, 112526..112608,112696..112775,112870..112972,113665..113862)


exon

Literature and cross-references RcAPx02 (29602.m000217)
DNA ref. Phytozome 11:   29602 (103512..113862)
Protein sequence: RcAPx02 (29602.m000217)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   288
PWM (Da):   %s   31911.37 Transmb domain:   %s   o259-281i
PI (pH):   %s   7.3
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLPVVDTEYMKEIDKARRDLRALIAYKNCAPIMLRLAWHDAGTYDKHTKTGGPNGSIRNEEEYSHGSNNGLKIALDFEEVKAKHPRITYADLYLAGVVAVEVTGGPSINFVPGRKDSKISPREGRLPDAKQGPPHLRDIFHRMGLCDKDIVALSGGHTGRAHPERSGFDGPWTKEPLKFDNSYFVELLKGETEGLLKLPTDKALLEDPEFRPYVELYADEEAFFKDYAESHKRLSELGFTPSSSGSKVIAKDSVILAQSAVGVAVAAAVVIFSYFYEVRKRMK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTACCGGTAGTTGACACAGAGTACATGAAGGAGATAGACAAGGCACGTCGCGATCTCCGTGCTCTTATCGCTTACAAGAACTGCGCTCCTATCATGCTTCGCTTAGCGTAACTT
ACTAACCATTCTCTTGGTTCCTTTTTTCTTTCTTTTCTTTAATCGACTGATTGATGAATAAATGGATTCTTGTTGTTGTTGTTGTTGTTGTTGCGTTTGTGAAGATGGCACGATGCAGGA
ACCTACGATAAGCACACAAAAACTGGTGGACCTAACGGCTCTATAAGGAACGAAGAGGAGTACTCTCATGGCTCTAACAATGGCTTGAAAATTGCTCTTGACTTTTGCG
GTCTGTTTTTT
TTTTTATAAAAAAAAATCCTTATTTATGTTAGATTATGTGCATGCACGTATTTAACAATGTCTGTTTTGTTTTGTTTTGTTTTGTTTTTTTTTTTTTATAGAGGAAGTGAAAGCTAAACA
TCCAAGGATTACTTATGCGGATTTATACCAG
GTGATTGTTTATTTAATTATATGTATTTTATTACCTAATTTTTTTTAGTTGCTAATATAGGAGCACAATTCAGCACCTAATCTTTTATC
ATAGCATAAAATTAAATTCAATTGAATTAAATTTAGTAAATTCTTATGGGTGGAAAATCCATAGTTGCTATAATTTAATTCTTTCAACTAAAATTAAAAAAAGAATGGGATTTGGAAAAG
GAATGAAATGATGCCAAAAAAATTGATGTGATTTTGCAAGAATTTGATTCTTAGGTATGATTTATTCCAAACAATTGGATATACTGTGGCGTACAACTCCATATTGGTTTTAGTAGTCCA
TCAAGATTTGAGCTCAATACTAGATGATGGATTATTTTTCCATGATTGATTACCTCCCCTAATGAATGGCTTTCACATCTAGTCACTTCTGTGTGACCAGAGAGAAAGAGACCATCTTTT
TGATATTTTAGACTTTAGTGATGATTGTTATTTATTGACATTAATAGCTTTAATACTTGGGAAACTAACATGGGTTTTGCAAATGAGGGGTGAGTTGACTTATAATAGATACTTCTACTT
TTAGCTTGCAGGTGTTGTTGCAGTTGAGGTCACTGGAGGCCCTTCCATTAACTTTGTTCCTGGCAGAAAGGTATCTGATTGTGTCGTTTCTTGAAGTTCTGCCTGCTTGACAGTGTATGA
TATAATATATTCTTTATTCTCTTTAAGGACTCCAAAATCTCTCCCAGGGAAGGGAGGCTTCCAGATGCTAAACAAGGTATTTTCAATGTTTAACTAATTCTCACTTCTTCCATCTATGAA
TCCATGTGTACTAAGCTTTTATGTTAAGTTCTGTTAATGACAAGTCCTGACTCTCAGAGTTATAGCTTTTCTAAAGTAATGCTGCAAATAATAATCTCTGAACTTCATTACTAAATCTTG
GAGGATGAAGACAGATTATCTATATAACATTAAGGAAGATAGTGTGTTGAACCATTTTTTTTTTTATTTTTTTATTTACTTTTATGCAAGTAGGTGTTGTAGACTAGTAGTGTAACAATT
GATCATGTGTTGCATTCTTAAGTTTCCTATGTTTAGTTTACATATTTAATAGCCAAAATTGGCAACTGTAACTTGAAATGTTTGTTTGATTGACAAGTTATGTGTGTGTTTGTGTGTGTG
TGTGGTGAGAGAGAAAGAGATTATCCATAGGTTTCAGCCTTTCAGGTCATTTTTCTTGCATGTGGTACAATGTTTAAGCTAGTAAATTACTGCAATGCCCAAGTAATACTTCATTCTTAA
TTGTTATGGAAGTTGTATAAGATCTTATATAGTAATTAGAAGACTAAAATTTAATTAAGAGTCCTAGTTCTACTTAGATTAGGATTGTATATATTGTGTATATATATATATAGGTGTAAC
TCCCTTGATTAAAAGAATATAAGATTTTCGGATTCTTCACTCAAATTACAAATTGTATGGTATCAGAGCCTGTTTTGTAGAGAGGGTTCTGGTCCTGCTGCTGCCTAACGTAGCAGCCAC
CAATTTTTTTTTTGGGTAACTAAGTTAGGGTGTCTCGGGTCCCCCTTCTCCGGCAGTTTGCTATTCTCACCGCCTGAACCTGGGGAAGCGCCTACCGCCAATCAGCCTATGTCTGAAGTT
TCGTCGCTGGAAACCCTGTGCGTGACTCCCAAGCGCCGCCACAAGCTTTCTGCTACAGTAACACGTGCCGGATGCGTGGAGGTGCGTCTGGAACCGGAAATTGCTCCGGTTTGTCTTGGT
TGACTTCTCTTGACTTCCACAACTTGTTTGTGTACCTGTTTAGGTCAGCATCAGTCATGGTATGAGATTTTTTTAGTACAGGTTTGATTTTTTCGGAAATTTTTTGTAGGCAGAATTTGT
TTTCTATATTTGGATTTGTTCTTCATAAAATATGGCTGAGAAAAAGGCTGTGGTTGTTTCTGATGTGGTTCCGGTGATGTCAAAAATTACGGAATATAAACTTAATGCTACAAATTATCT
TTATTAGCGTCAAACTATTGAGTTATATTTGCTAAATATTTCTATGGATAGCCATTTGACTGATGATCCTCCAAAAGAGGATGCTAGACTACCTTGGATGAGAGAAGATGCTCGCTTGTT
TTTACAGATACGTAATTCTATTGATAATGAGGTGGTTGGTATGGCTACTCATTGTAGGACAGTCAAACAATTAATGAGTTATTTAGAATTCCCATATTTGGAAAAGGGTAATGCTTCTCG
AATTTATGATGTGTGTAAAGCATTTCATAGGGCGTAGAAAGGTGATAAGTCTCTCACCAACTATTTTATGGATTTCAAGAAAACATATGAAGAACTTAATATGTTGCTTTCATTTAGTAA
TAATATAACTATTCAACAAGCTCAACGTGAAAAGATGGCTGTGATGAGTTTTTTAGACGGACTCCCTTTGGAATTTGAGACTGCTAAATCTCAGAGTCTTTCCAGTTCATAAATTTCCTC
TTTACAAGAGGTTTTTAGTAGAGTCCTTTGTACAGAAAATTCTTCACCTGTTCAGCTTAGTATTGTCCGGGTTAGTCGCAATACTACATATGAATCAGGAAGACAATAATATAAGATCGG
GAATGGTAGTAAAATGATAGTATCTAGCAACTATGACAGGTATACTAATACTTGTGGACAAGAGTCAGGAGAGATAATGTGTCACTACTGTCATAAACTAGGACATATGAGACGAGATTG
CAGGAAGTTGCAGTATAAGAAAACTCAGTCCGCCAATGTTACATCCACCATGGATACCTCTGAGAGGCCTGTAATGGTATCTGCAGATGAGTATGCAATATTTTGTCCAGTACCAAGAAT
CACTAAAAACTCAATCTCCTCCTATTACTACCATTGTTGAATCAGGTAAATCCAATACATGTCTTGTTTCCTCCTCTTCGAAATGGGTCATTGATTCTGGTGCTATAAATCATATGACAG
GTAATGCAAAATTATTTTCTACCTTTCAGTCACATAAATCTACCTCTCCAGTTACTTTAGCAGATGGGTCAACATCTTGTGTTATTGGGTCTGACACAATTAATGCCACACCGTCATTTT
CTTTATCATCAGTTCTTAGTTTATCACAACTATCATTTAATTTAATTTATGTAAGTAAACTCACTCACAGTCTTAACTGTTGTCTCATTTTTTCCTGATCATTGTTTATTTCACGATCTT
ACGACGAAGATGATTATTGGTAAGGGACATGAGTCTGGGGGTCTCTACATTCTTGATACACAAATTGCAAGATCTATAGCCTATTTTGGAGTGATGACACATTGTAGGTTGGGCCACTCA
TCTCTCCATGTGCTAAAACAACTTTGTCTTCAGTTTCAGAGTCTGTCTTCATTAAATTGCGAGTCTTGTCAGTTTGCTAAACATAATCTTCTTAGTTCAAGTCCTAGAGTCAATAAACGA
GCTAGTGCTCCTTTTGAGTTAGTCCATTCAGATGTTTGGGGTCCATGTTCCATTGAGTCCAAAACTTGATATAAGTATTTTGTTACTTTTATTGATGATTACTCTCGTATGACATTGTTA
TATTTAATGAAAAATTATTCGGAGGTGTTTTCTCATTTTTCTACTTTTTGTGCTGAAATTACAACATAATTTAATATTTCTGTACAAATATTGAGAAGTGATAATGCTAAGGAGTACGTA
TCAGAATCCTTCCAAACTAAAACACTGATTCCTGTTGAGCCTAGGATATTTGGGTTTACATTCTTTGTTTGGGATGTTCGTACTCTGGTTACCAAGCTAGATCCAAAATCTTTGAAGTAT
GTTTTTCTTGGCTATTTTCGTGCTAAAAAAGGATATAGATGTTACTGACCTTCTTTTAACAGATATCTTGTTAGTTGATGTTACTTTTTTGGAAGATACACCTTTCTTTCCATCTACTCC
TCCTTTAAGTCAGGGGGAGGATGGGGATTTTGTAATTTATACTGTTACACCTACTCTTGATAAACCTAAGCCACCTATAGTACAAGTTTATTCTCGGCGATCAACCCCTCCGGATCCATG
TTCTGAACCAACTCCTTCGTTGTCAAATCCAGTCTCTAATGATGATCTTCTTATTGCTCTTTGTAAAGGTAAGCATACATGCACTTATCCAATGTCTTCCTTTGTGTCTTATAATCAATT
GTCGTCCTCCTCTTCTTTTATTGTATCTCTAGATTCTATATATATTCCTAAGGCTGTTAAAGAAGCCCTTTCTCACCCTGGTTGGCTTAATTTAAGGAGATGAGTGCTTTACAGGATAAT
GGTACTTGGACCTTAGTTGATTTGCCTGCAGCTAAGAAAGCTATTGGGTGTAAATGGGTATTTGCTATTAAAGTCATTCTTGATGGATCCATTGCAAGATTAAAAGCCCGTCTTGTTGCT
AAAGGATATGCTCAAACTTATGGAGTAGATTATTTCGATATATTTTCTCCTGTTGCTAAGATGACTTCCATAAGATTGTTTATTTCTATGGCGGCTACTTATAATTGGCCTCTTCATCAA
TTAGATATCAAGAATGCTTTTCTCCATGGGGATCTTCAGGAGGAAGTTTATATGGAGCAACCGCTTGGCTTTGTTGCTCAGGGGGAGTATGGGAAAGTTTTCTATCTTCGCAAGTTTCTA
TACGGATTGAAGCAAAGGCCTCGTGCTTGGTTTGGAAAGTTTAGTCAAGCAGTTGAGAAGTTTGACATGAAGAAAAGTAAGTTGGACCATTCTATTTTCTTCAAGCATTCTGCTGTAGGT
ATCATTCTGTTAGTTGTGTTTGTGGATGATATTGTCATTATTGGGAGTGGCACTACAGAGATTTCATCCCTTAAATATTTTCTCCACATTCAGTTTCATACTAAATATTTGGGAATGTTG
AGATACCTCTTGGGTGTTAAGGTAATACGAAGTAAGAAGGGAATATTTTTATCTCAAAGGAAATATGTACTTGACCTGTTGTCCGAGATAGGAAAGTTGGGAGCTAAGCCATGCAATATT
CCAATAGTTCCTAATTTGCAGCTCACAAATGATGATGAGTTATTTAAAGATCTTGAGAGATATAGAAGATTGGTTGGGAAGTTGAATTATCTTACTGTGATTCGTCCAGATATTGCATAT
TCAGTTAGTGTGGTGAGTCAGTACATGTCCTCTTCAACAGTTAATCACTGGACAACTGTCGAACAAATTTTGTGCTACTTAAAAGGAGCACTTGGGCGAGGAATATTATATGGTAATCAT
GGTTATAATAGAATTGAATGTTTTTCAGATACTGACTGGGCGGGTCTAAGGATGATTGAAGATCTACTACAAGCTATTCTGTATTTGTTGGAGGGAATTTGGTTTCATGGAAAAGTAAGA
AGCAAAATGTTGTCTCACGTTCAAATGCGGAATCAGAGTATAGAGCTATAGCCAAGTCAATATATGAAATAATGTGGATATACATCTTTTAACTGAAGTAGGACTTAAAACTTCAGTACC
GGCTAAGTTGTTGTGTGATAACCAAGCTGCTCTTTACATTGCATCAAATCCTGTATTTCATGAACGAACTAAGTATATCGAGATTGACTTCCATTTCGTTCATGAGAAGATTCAGCAAGG
TTTGATTTCCACAGGTTATGTTAAGACAGGAGAACAACTAGGAGATACTTTCACGAAGGCTCTTACTGGGATTCGAGTTTATTATCTCTGTAACAAGCTGGACATGATTAATATTTATGC
TCCAGTTTGAGGGGGAGTGTTATGAAAGTTGTATAGGATTGTATATAGTAATTAGAAGACTAATTTAATTAAGAGTCCTAATTCTACTTAGATTAGGATTGTATATACTGTGTATATATA
TATAGGTCTAACTCCCTTGATTAAAAGAATATAAGATTTTCGGATTGAATATAAGATTTTCGGATTCTTTACTCACGTTACAAATTACATTATTAAAGGGTCCAATTAGTAGTCGAAGTA
CTTGCTGCATCTCTTCTCTACAAGTTGGTATACTCCTTCCCCTCCTGTTGTTTCTGGTAAAAGGGCATGATATACTGAGGTTGTTAATATGTTTGATCAAGGAACTTTAAGGATTCATTA
ATTCAGGCTCAAAGCCTGCTTTACTCTTTTAATCTTAGTTCAAGAAATTCATTCTATATTTATCATTCAGTTGCCACTTGCTTTACATTTTGACTAGAATATATCTCTATATTGATCTCA
TTTATCACAGGCTCACAGCTTCAGTTCTATATTATATAGATACTTCAGTTTGCTAAGTATGATATTTGTGCTCACATGTTTCAGGCTTGTTTTGCAGTCTACTGTTTCTAAATAGGACCA
CAATTGCTTAACCTGACCTCATGTCTGTGTGGGCTTATGTTGACACCTCTACTGTCAATGCTTTACCTGAGTCCTCTTGTACTTGTGGATTCAGATGAAAAAGAAAGTTTCTTCTTAGTA
CTTTAAGTCTTGATTTCTGTAATGGGTCCCATCCAGATTCTGCCGATATCGTTGCTTGTTTGTATAGCAGTTGAAATCAAGTGACTGAAATCTGATGTGCACAGTCATACTTGATGCAGG
AACTCTGTCTAACCAAACCTCAAGGGCTTAGCTCAAGTCGAGGCTTGGATTTGGTTAAGTTAAATACTTGGAACACCTTTATATCCTAATATGTCCTCCTGTGTGTGTTGGAAATGTTCT
TAAGTTGCTGTGTTGCTCATTGTTGTCTAGAACTTCAGCGTTTTATCATTCTTTTTCTAAACGGGACATAGAGCACGCTGAAATATCCTGCAACTTGAATTGTTGTTTAAAGGTCTTAAT
ATCCTATTCACAAATGTGCAGCTGCATCAAGAAGTTGCCTATGGAATTCTACTTAGGAGATGGGTATAGTAGATTTCTATTTAAAATTTCAGGATTGGTTTCCTATTAATATAGGGATCT
AAGCTTCAAGAAATACAGACTTTAGTTCAAGCTAATCAGAGTGAAAGGCAGCAGTTAGGGGTTTGCAAATTGCACTCTCAATTGGATCAACAATAAACTGCAATATCATCAAAACTTACA
TATTATTGGAGATTATTCAAAATGTCTGCTAACATTGCTAACAAAAATATTAATACTAATAGATGAGGGGTTCATATTAGATAAGACTGAAAGCATATTGGTTGGAACAGTCTCTTGGTC
TTACTCTTTGTGAATTTGCTGTTTCGAAATAGTCTTATCATTGAGATGGGGTTGTGAAACAATTTAGAGGTCTAACTTTGTAATTAATTTTATTCATTTATATCTAACACATCTCAAGAG
ACTTAATATTGTGAGAAAGCATCAGGTAAAGCAGTAGAAAATAACATAATACTTTGGTGTTTGACTAATAGGAAACATAAGAAAATTCCAACTATTCCTAGTTTACAGCATTTAGTCTCT
CTCTATTGTGATATTTCTTGCAACCAGAGTTGAGTGGAAGTTTGAGTTTTTCGCTTTTTTCTAGCTGCATTCCCACTATTTTCCCTCTTTCAAGAAAGTCAAATGATCAAAGCAGTTCAA
TCAGTTAAATGCTTGTTTCCCCTTAGGATGCTATAAATACAAGATCTATTTTGGTTTACAGGGCTATCCCTTGTATTCCTAGCCTAACTGGAATTCTTGACTTCATAAGACATTAATAGT
CCCTCACACGAGGATATATATTTATATTTATATATTTTAAATATTTGGGAATTGAATTCTTATATATTGTAAGCATTAAATAAGAACTAGTTGTCTACTTCTGCAGCTTCTATATTTTAA
TTTTCTTTTTTGGATTTGGCATTGAAATTTTTGTTGATTATTACTGTACATAATAATTGTATAACAATGGTTTGTGGTATTAATTTTGTTGAATCATGTTAAAGGGAGGAAAATAAGTAA
GAAATGAGTATTTTATATTATGTCATTGACCGAGAAATATTAAAATTGTTTCTCGGAGAGGAAAATTAAACTAGGTGTTGTTTGAGGATAGAGAAAAGGCCTCGGAAAGTTAAATTAGGC
AGTGTTCATTTATTACTGTGTATCTGAGGGTTCTTTCATGCCTACTCCTAAAATGCATATAAACTTTATAGTTGGTAGGAGTGTTCTTGCAAATCTGTTCAGTTATCTCATACAATGCAA
ATATTACTACTGCGTTTTGGTAATTTTCTTTTAAAAGTTACTTTCTAAGGATTATTAGTCAGTGTTATCAAATAGTTGCCATACAATTGCCGGAATCGATATTGTTTATCCTTCATATAA
TTTATCAGTTGAAACTCTTCAGTTGAGTGCAAAGTCATAGAAATACAATGTTGATCTGTGGCTCCGGATTTCAGAAAGTAGATTTCATGTATTAAGCAATTTTATGCTAATGCTCTTTTT
TTTGTTTCCATTCTGTAACCTAGTGTTAAAGGATTCTTAAGAGAAGTACTTCCATATCATGCATAGTTGTGTAGGCCTGTCTGTAAGCTATATGTTTTTGCGTGCAACTAAGCAGGGTCT
GAATTTTATGGTAGGTCCACCACATTTAAGGGATATCTTTCACCGAATGGGTCTGTGTGACAAAGATATAGTGGCACTCTCAGGGGGTCACACTCTGGTACTTATCATCTAATAGCTGTT
TTTATCTAGTTGGTAATCAGTTATATACAAAGATATAATTGTTTTGTTGGCTATTATTATATAGGGAAGGGCACATCCCGAGCGATCAGGTTTTGATGGCCCTTGGACCAAGGAGCCTCT
GAAGTTTGATAACTCGTATTTTGT
GTAAGATTTGAACCGAGAGTAGCAAAATGTTTCACCCTTTGTTATAGAATCTATGAATTCAAATTTATCTATCTGCATTTATTGGCGGTTTTAGGG
AACTGCTGAAGGGGGAGACAGAGGGGCTGTTGAAACTTCCAACTGACAAGGCTTTGTTGGAAGACCCTGAGTTTCGTCCTTATGTTGAGCTGTATGCTAAG
GTAAAAAGAGATTCTACTT
TAATTATAAACCAATATTTACTGTGTGATTGTTAAAATTCGACCATGTGGTGACATTCAGAATTACAATTAGCATGGACATATAAAAACTGTTTGTGTCTAATTTTTGCATCTAATATTT
TTAGCTTCACCTATTAGGAGGTTTACTGTCATACTGTAGTGGGATTGTCTAATCTACTCATGACATGCAAAAACCAATCGACTTGGAATAAATAAAATTGGGATCAGTTTGAAAAAGTAA
ATTATGATGAGCCAGTGTTCAGATAAGTTATTTTAGTTCCCTGCCAACCTCTGCAAGGTGTTTCTTTTCCATGCAAAATGGGTGGAGATTAGAGCTGATTTGGTTAATGTGAATCTGCCC
CTGTCCTTCTCAGCATGAGTTTATATTCCTTTTTCTGGAACATCTCAATGTTTCTGTTAGTTTGAGAGGACAGGAAGTAGGAAGGGTGAATTTTGATTACATTATGATTAGGTGCAAAAT
AGGAGGGAAACATACATAGTCTATATACTGTTTTCGAAATTCTAATCCATGCCCTTTTCCAGCCTCCTAAACCAAACATAGCCTAAATGTGACCTAGAATCATATGTAATAAATACACAA
ATCTTGGGTTGGTGTATATCCTGGTTCATAATATGTAGCATAATTTCTTTTATGCAAATTTGGTGGATGCCAGGATGAGGAGGCGTTTTTTAAAGACTATGCAGAATCACATAAGAGACT
TTCAGAACTGGGGTTCACCCCAAGTTCCTCTGGATCCAAGGTTATTGCAAAGGACAGTGTAATATTGGCGCAAAGTGCAGTTGGGGTTGCAGTTGCTGCTGCCGTTGTGATCTTTAGCTA
TTTCTATGAAGTTCGCAAAAGAATGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTACCGGTAGTTGACACAGAGTACATGAAGGAGATAGACAAGGCACGTCGCGATCTCCGTGCTCTTATCGCTTACAAGAACTGCGCTCCTATCATGCTTCGCTTAGCATGGCAC
GATGCAGGAACCTACGATAAGCACACAAAAACTGGTGGACCTAACGGCTCTATAAGGAACGAAGAGGAGTACTCTCATGGCTCTAACAATGGCTTGAAAATTGCTCTTGACTTTTGCG
AG
GAAGTGAAAGCTAAACATCCAAGGATTACTTATGCGGATTTATACCAG
CTTGCAGGTGTTGTTGCAGTTGAGGTCACTGGAGGCCCTTCCATTAACTTTGTTCCTGGCAGAAAGGACTCC
AAAATCTCTCCCAGGGAAGGGAGGCTTCCAGATGCTAAACAAG
GTCCACCACATTTAAGGGATATCTTTCACCGAATGGGTCTGTGTGACAAAGATATAGTGGCACTCTCAGGGGGTCAC
ACTCTG
GGAAGGGCACATCCCGAGCGATCAGGTTTTGATGGCCCTTGGACCAAGGAGCCTCTGAAGTTTGATAACTCGTATTTTGTGGAACTGCTGAAGGGGGAGACAGAGGGGCTGTTG
AAACTTCCAACTGACAAGGCTTTGTTGGAAGACCCTGAGTTTCGTCCTTATGTTGAGCTGTATGCTAAG
GATGAGGAGGCGTTTTTTAAAGACTATGCAGAATCACATAAGAGACTTTCA
GAACTGGGGTTCACCCCAAGTTCCTCTGGATCCAAGGTTATTGCAAAGGACAGTGTAATATTGGCGCAAAGTGCAGTTGGGGTTGCAGTTGCTGCTGCCGTTGTGATCTTTAGCTATTTC
TATGAAGTTCGCAAAAGAATGAAGTAG

Retrieve as FASTA