Entry information : RcAPx04 (29648.m002024)
Entry ID 9330
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcAPx04 (29648.m002024)
Name (synonym) RcAPx04 (29648.m002024)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcAPx04
start..stop
S start..stop
MeAPx05 608 0 3..360 17..378
HbAPx02 597 0 3..354 2..358
MeAPx01 598 0 3..354 18..374
PtAPx07 588 0 3..360 19..374
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 797175..797357 183 N° 2 797452..797562 111 N° 3 798175..798295 121 N° 4 798372..798472 101
N° 5 798567..798654 88 N° 6 799462..799529 68 N° 7 799616..799702 87 N° 8 800636..800710 75
N° 9 800806..800883 78 N° 10 801414..801518 105 N° 11 801919..801981 63 N° 12 802123..802125 3
join(797175..797357,797452..797562,798175..798295,798372..798472,798567..798654, 799462..799529,799616..799702,800636..800710,800806..800883,801414..801518,80191 9..801981,802123..802125)


exon

Literature and cross-references RcAPx04 (29648.m002024)
DNA ref. Phytozome 11:   29648 (797175..802125)
Protein sequence: RcAPx04 (29648.m002024)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361
PWM (Da):   %s   38865.93  
PI (pH):   %s   8.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASLAGAASSRLLPSASRSRLSLSSSSFSSLSLSASSSYSVSPLISLRSSPIVPRIFLNKKGSLMSTVAAASDPAQLKSAREDIKELLKSKFCHPILVRLGWHDAGTYNKNIEEWPQRGGANGSLRFEVELKHGANAGLVNALNLLKPIKDKHSGVTYADLFQLASATAIEAGGPKIPMKYGRVDVSAPNECPEEGRLPNAGPPSPADHLREVFYRMGLNDEIVALSGAHTLGRSRPERSGWGKQETKYTKNGPGAPGGQSWTAEWLKFDNSYFKDIKEKRDEDLLVLPTDAVLFEDPAFKVYAEKYAEDKEAFFKDYAEAHAKLSNAGAKFDPPEGIVLDGAVGEQFVAAKYSSGKD

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra sequence at 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTCACTCGCAGGCGCCGCCTCTTCTCGTCTCCTCCCCTCCGCTTCTCGCTCTCGTCTGTCTCTATCCTCCTCCTCATTTTCCTCTCTCTCTCTCTCTGCGTCTTCTTCTTAC
TCAGTTTCTCCTCTGATATCTCTCCGATCTTCTCCTATCGTACCTCGCATCTTTCTAAATAAG
GTTTGCGATCTATTTTACACTATGCATTAAAGCATTTTCAGTTTTTGGAGAATATTT
AGCTGTTTATAGCTGATCATCTTCAATGGAGTCGCAGAAAGGATCGTTGATGAGTACGGTTGCTGCGGCGTCGGATCCTGCTCAGTTGAAGAGTGCCAGAGAAGATATTAAAGAGCTTCT
CAAGTCTAAGTTCTGCCATCCTATTTTG
GTAAATAAAAATTGCTACTACTATGTAAATGTTGTGTTTATATTTATATATACATTTTGCAGGTAAGCTTATTTAGTGATTTGATCTAGCTG
TATACTTAGCTCTTAATTTCGATTTTAATGCTTGAAATTTATAAAATGTGGTGTCTCAGTGGTAGTTATCCTTCAATTTTTGCTGCTTTAATTTTTTTTTTTAAATCTCGAAAAGCTAAT
ATTATGTGGAGCATATGATATTTCTATGTGCTCTGTTGTGAACTTGTTAAGAATGATTTGATCTGGCTGCTGTATTTAGCTCTTTCTTGGTTTGCATCTTGATTATCTTGCTTAAAAGGT
ATTCTGTAATGGTAGTTATGTTCATTTGAGCTGATTTTAATTTTGTTGCTTTATTTTCCACGACGGAGATGGTTATTTTTTTTTTAAAATATTGAAAATGTAAATAAAGGTGATTTTCTA
TTTATTTTTTTTAAATGTCGAGAACCTAATATTTATAATACATATTAATACCTCATAATGCATATCAAATTTGAAGATTAAGATACTTATTATTTCAAGATTTTCAGATGCTAATCGTGC
AATTTGTTTTAAGATTTTAATTTTTCTTAATGAATTACAGGTTCGATTGGGATGGCATGATGCTGGAACATACAACAAGAACATAGAGGAGTGGCCACAAAGAGGTGGAGCCAATGGAAG
TCTCAGGTTTGAAGTTGAGCTGAAACATGGAGCCAATGCAG
GTATTATATCTTTTCTCATCTATAAATTAGCTCTTTTCTTTAAATCACATTTATTCCTTATGAGCTGTTACTTTAGGAC
TCGTGAATGCGTTGAACCTTCTAAAGCCTATCAAGGACAAGCATTCTGGTGTAACATATGCGGATTTGTTTCAATTGGCTAGTGCTACTGCTATTGAG
GTAGAGGGTCTTGATTTCTTTT
AAAATGAATTTAGTATGATGTTTCAGTTGATTGTTAAAATTGGATATTGATAAATTTAACTTACAATTTCAGGAAGCTGGAGGTCCCAAAATCCCCATGAAGTATGGAAGGGTGGACGTT
TCAGCACCTAATGAGTGCCCTGAAGAGGGCCGTCTTCCTA
GTGAGTGCATTTGAGTTGTATACTCTTCTTTTTTTTTTTAAAAAAAGTGCCTATTCCTGTGTGGGTTCCTTTATAAAATG
TGGACTGGAATTCTTATGAAATCACTGCTGCTGCTGCTTGATGACTTAAATCAAGAAATAATAGTAGAAACATGTTTCTTTTCTCCTTTTCACTTTTCTTCTTTTTAAAAGGAAGAACCA
AGGTTGCATTCTGCGAATGATATGCTCGTGCTTGTGGAAAGCCAACAAAAATTGATGAACCATGTTAATATGCCTTGTTTGCCTATCTGACTTTTAGAGTTCTGGCTGGTTTCTAATATT
GTTAAGCAGGATTTTTTACTATTATAGTATGCTAATTTATCTGTCTAAATTCTTGGTACAAATAGGTCACTGTAATCTGGTCTCCATACTTCTTGATAATATTAAACCATTTTAATTATC
GGATAATTAAATCTGAGTCACCTTATCAGTAAGCAGCCACTGTGTTTTAGTTATCCATGTCCAGGTGAGAGAGTTAGGATTGTTTTTGTTTTATGCAGCATCCATGACAGCAGTTGCCTA
GTAGAGTAGGCTTTTCCATGTCATTTTTGAATTTCATACTGGGGTTTTCAGTATTTAATATATATTGGTGAATTGGACCTATAGATGTCTTCTGTTGATGAAATATTCTATTTTAGGCAG
TTGAATCCTTCAGACCTTTTTCCAGAATAGTTTAATATAGTTCTATTTTTGTTCCTCTTAACTATCTGAGGCTGCCTGTGGACAACTTCTGCATAACTGATTGTTAAAATATTTGCATGA
CGCTTAGATGCTGGTCCTCCTAGCCCTGCTGATCATTTGAGAGAAGTTTTCTATAGAATGGGATTAAATGACAAGGTAACCTTAACTCTATAAATATTTTAGTGTTTATTTTATCTTTAT
ATGCATCCGGTGTTCATTGTTGAATTTTTTTTTCTCTACAGGAAATAGTAGCATTATCTGGTGCACATACTTTGGGAAGGTCCAGACCAGAACGTAGTGGTTGGGGCAAACAAGAGACAA
AGTATACG
GTATTAAGCGCAATCTTTTGACCAGTTAGATATAGTATAGTTTATTTGTCTGAGTAGGTTAGAATTGGACATTTGTCGTTCACTTGTTTCCAATCTTCAACTGAGGATTCGA
GACTTAGAAATCAAATGGTTATGCAATGAATTGTACTTTATTGTAGAAGAAGCTAAAGGTTCTTTTAGAGCCTGCCCTGCGAACTCATTTTGAATCTCTACAACTCTTAGATCCACTTCC
ATTTCCTGTTTTTTGACGGGTGTTACTAACATTCTTTTTTTTTCTTTCTATATGTTACTGCCTTGGTGGCAGCAAGAATATGAATATGACCAGAAAATTGAAAAGTGCAACTTTATATTT
ATTGCAGTGGTCAAAGCTTAGTAATGCGGTTAACTTTTCTTACCTTGAAATGTTCAAGAAGTGAAATCGTGTTTGTTAAACAACCTGGCCTGATACTTTAATGATGGATTTGACAATGTC
TTTTTTGATGCGCTAGTTGTTCACTTGGTCATGTATTTATTGATGAAGTTTTCAAGTCTTCATAATCTCAGTGAAACTTCTTAAAATGTCTAATTGCTAGCATATGGTTTCAGACGAAAG
GTCAGAATTTATTTTTCACATGCTAAATCTCTATGGCCCGTTCACTTAACTGTTACATGTATTCTTATTGTCCTTAATATAATATACTTTTGAGCATTTTGACGTATGATCTATAGCATC
TATATTAGTTTAACATTCATTTGTGTGAGTGGGTTTGACTGTATGATTGTACATGTGTGCATCTTGATTTGTCGTCAAATTCCTATCAAGGCCTTTTTACTTCCTCCTGTGGAATATATT
CATTATATCCTGGAAAACGATTGCAATTATAGTAGCAATAACAGCTTTAACAACAGCAATAATAAGAGTTATCTTTTCATATTGGATCTGCTGCATGACAGAAAAATGGGCCTGGAGCTC
CAGGAGGACAATCCTGGACAGCAGAGTGGCTGAAATTTGATAATTCCTATTTCAAG
GTTTGAAGGGAAAACTTGCTATTTAGATCACGTGAAAAGAATTAGGTGGCAAGAGGTGGTAATT
CTTGATTGTTGAATGTGACTTATCCATACAGGATATTAAAGAAAAAAGGGATGAAGACCTGCTTGTATTGCCAACTGATGCTGTTCTTTTCGAAGATCCTGCATTCAAGGTAAATTAATT
ATGTTTGAGCAAGATGGGTTAAGAGACGTACAATATGCTGAATCAATTATCTTGAAAATAATTAGGGAAAGTACAAAAGTGTATCCTTTGGTTGCACCTTTTTTCCATTTAGGACTGACT
TTTTTCTTGTCATTTTCGGGTTTGTAGTTTTTTTTCCCTTTCATTCTTTACCCTCCCAACTAATGTTGATATATATTTTTTAATGTCAAAACATTAATAAACATTGATTTTCAATAAAAA
AAGTCATTTTTCTAAGTTATTTACTGTCAAACTGACTAATAGGATAGTCCTAAAAATATATAAACTTATTTTAAAAATTATTTCATCTTATTTCTCATAAAATTAAAAAATACGTATTAA
TTTATTAATCTTGCGTTCATTATAATTAGTTGTATATTGAAAAGAAAATAAAGCTAAAGACTTTAAAATAATAAGATTAAAATAAGGGACGTAATTTTTTATACTTTTTTCCAAATATTA
TATCTTGTTAAAGGTAGCTAAGCAATATAAAATTTGCAGGTATATGCTGAAAAGTATGCTGAAGATAAGGAGGCATTCTTCAAGGATTATGCTGAAGCCCATGCTAAGCTGAGCAATGCA
GGGGCCAAATTTGATCCTCCTGAG
GTTTGTTATCACGAGTGTTATGAGTGCTTGTCTTTTGGTGCTACATTTATTCTTTTTCTTCTTTTACATGTCATTACCCTGACTCAATTCCTTTGC
ATAAACGAATGCGATATCGTTTTGGCTGTTGTAAAAACTTCTGTCTTAAAATAGGCGTCGAATTGATGAAATGTAACAGGTACCTGAACATGTGTATCTAGTGATTCTTCATGGGTTCAG
CCTAACTAATCCTTACTAATTGGTTACATTAGGCACACCCGACAATGCACGGAAACCTGTACACAAGCGCACCTACTATTTCTCTGTTTCCTTTGATTTGGCTTGGAAATCCGATCAATT
AATTTTACTAGAATAGTAGAAAGTCGGTGACTTTGAGAAACTGATTGATGAATTTGATGATCAGGGTATTGTGTTAGATGGCGCTGTGGGAGAGCAGTTTGTGGCAGCCAAGTACTCATC
TGGGAAG
GTTGGAACTAGAAAGTGTTTCATTTATTTTTTGTATAGGGGTTATCAATTCCTTGCTTATTGGTCACGTGAAAGATTTTTACGTAGGAAATTAAATTTTTGCAAAATTGTTCA
TTTTTTTTACTTTTCATGATTGCTGCAGGAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTTCACTCGCAGGCGCCGCCTCTTCTCGTCTCCTCCCCTCCGCTTCTCGCTCTCGTCTGTCTCTATCCTCCTCCTCATTTTCCTCTCTCTCTCTCTCTGCGTCTTCTTCTTAC
TCAGTTTCTCCTCTGATATCTCTCCGATCTTCTCCTATCGTACCTCGCATCTTTCTAAATAAG
AAAGGATCGTTGATGAGTACGGTTGCTGCGGCGTCGGATCCTGCTCAGTTGAAGAGT
GCCAGAGAAGATATTAAAGAGCTTCTCAAGTCTAAGTTCTGCCATCCTATTTTG
GTTCGATTGGGATGGCATGATGCTGGAACATACAACAAGAACATAGAGGAGTGGCCACAAAGAGGT
GGAGCCAATGGAAGTCTCAGGTTTGAAGTTGAGCTGAAACATGGAGCCAATGCAG
GACTCGTGAATGCGTTGAACCTTCTAAAGCCTATCAAGGACAAGCATTCTGGTGTAACATATGCG
GATTTGTTTCAATTGGCTAGTGCTACTGCTATTGAG
GAAGCTGGAGGTCCCAAAATCCCCATGAAGTATGGAAGGGTGGACGTTTCAGCACCTAATGAGTGCCCTGAAGAGGGCCGTCTT
CCTA
ATGCTGGTCCTCCTAGCCCTGCTGATCATTTGAGAGAAGTTTTCTATAGAATGGGATTAAATGACAAGGAAATAGTAGCATTATCTGGTGCACATACTTTGGGAAGGTCCAGACCA
GAACGTAGTGGTTGGGGCAAACAAGAGACAAAGTATACG
AAAAATGGGCCTGGAGCTCCAGGAGGACAATCCTGGACAGCAGAGTGGCTGAAATTTGATAATTCCTATTTCAAGGATATT
AAAGAAAAAAGGGATGAAGACCTGCTTGTATTGCCAACTGATGCTGTTCTTTTCGAAGATCCTGCATTCAAG
GTATATGCTGAAAAGTATGCTGAAGATAAGGAGGCATTCTTCAAGGAT
TATGCTGAAGCCCATGCTAAGCTGAGCAATGCAGGGGCCAAATTTGATCCTCCTGAG
GGTATTGTGTTAGATGGCGCTGTGGGAGAGCAGTTTGTGGCAGCCAAGTACTCATCTGGGAAG
GAT

Retrieve as FASTA