Entry information : RcPrx13 (28962.m000432)
Entry ID 9344
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx13 (28962.m000432)
Name (synonym) RcPrx13 (28962.m000432)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx13
start..stop
S start..stop
MePrx02 580 0 1..317 1..316
MePrx121 557 0 1..317 1..318
PtPrx44 545 0 1..317 1..317
GhPrx23 534 0 1..317 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5931..6137 207 N° 2 6218..6406 189 N° 3 6487..6649 163 N° 4 6723..7114 392
join(5931..6137,6218..6406,6487..6649,6723..7114)


exon

Literature and cross-references RcPrx13 (28962.m000432)
DNA ref. Phytozome 12:   28962 (5931..7114)
Protein sequence: RcPrx13 (28962.m000432)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (300)
PWM (Da):   %s   33884.04 (32198.1)  
PI (pH):   %s   8.57 (8.57) Peptide Signal:   %s   cut: 18 range:18-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASILALLLSSILMASALSPGNGLSLNYYEKTCPDVDTIVTDAVRDAMARDKTVPAALLRMHFHDCFIRGCDASVLLNSKGSNKAEKDGPPNVSLHAFYVIDNAKKEVEASCPGVVSCADILALAARDAVALSGGPTWDVPKGRKDGRTSKASETIQLPAPTFNISQLQQSFSQRGLSMDDLVALSGGHTLGFSHCSSFRNRIHNFNATHDIDPTMNPSFAARLKSICPKNNKAKNAGAPMDPSSTTFDNTYFKLILQGKSLFSSDQALLTSTGTKDLVSKFATSKDTFSEAFVKSMIRMSSITGGQEVRKDCRVV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTATTCTTGCATTGCTCTTGAGCTCAATTCTCATGGCTTCAGCACTTTCACCAGGAAATGGGCTGAGTTTGAATTACTATGAAAAAACATGTCCTGATGTCGACACTATTGTT
ACAGATGCTGTCAGGGATGCAATGGCAAGAGACAAAACAGTTCCTGCAGCTCTACTTAGGATGCATTTCCATGATTGTTTCATAAGG
GTAGGAAATGAAACAGCATACTTGTTTTCTTAG
ATCACTTATATCTCCAACTTACTGCTTGTTGTCTGTTTGTTTCTAAGGGCTGTGATGCTTCAGTGCTGTTAAATTCAAAAGGCAGCAATAAGGCAGAGAAAGACGGTCCACCTAATGTTT
CACTACATGCCTTTTATGTCATTGACAATGCAAAGAAAGAAGTTGAAGCTTCGTGTCCTGGTGTAGTTTCTTGTGCTGATATTCTGGCTTTAGCTGCAAGAGATGCAGTTGCACTT
GTAA
GACAACAGAACAAGCTAGTAAATACATTCTTCTTATATTCGTTAAAATTTCTTCTGATTCTAAATTCTTCCTGTAGTCTGGAGGACCAACATGGGATGTGCCTAAGGGAAGAAAGGACGG
GAGAACATCAAAGGCAAGTGAAACAATACAATTGCCAGCTCCAACTTTTAACATCTCTCAGCTGCAACAAAGCTTCTCCCAAAGAGGCCTGTCCATGGATGATCTAGTGGCTCTTTCAG
G
TAAACAAAGGGTTGCTTGTATCTCCTCACCAATTACAACAAGATGATAATGTTATAAATAACCAATATGCAGGTGGGCACACTCTAGGTTTTTCCCACTGTTCGTCCTTCCGGAACAGAA
TCCACAATTTTAATGCCACTCACGACATAGACCCAACTATGAATCCCTCATTCGCAGCAAGGTTAAAAAGTATTTGCCCTAAAAACAATAAGGCGAAGAATGCCGGTGCCCCCATGGACC
CTTCCTCAACGACTTTTGATAACACGTATTTCAAGTTGATCCTCCAAGGAAAAAGCCTGTTCTCTTCAGACCAAGCTCTTCTCACAAGTACAGGGACTAAAGATTTAGTTTCCAAGTTTG
CTACCTCCAAAGATACTTTCTCAGAGGCATTTGTCAAATCTATGATCAGAATGAGCAGCATCACAGGTGGCCAGGAGGTTAGGAAGGACTGTAGGGTGGTAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTATTCTTGCATTGCTCTTGAGCTCAATTCTCATGGCTTCAGCACTTTCACCAGGAAATGGGCTGAGTTTGAATTACTATGAAAAAACATGTCCTGATGTCGACACTATTGTT
ACAGATGCTGTCAGGGATGCAATGGCAAGAGACAAAACAGTTCCTGCAGCTCTACTTAGGATGCATTTCCATGATTGTTTCATAAGG
GGCTGTGATGCTTCAGTGCTGTTAAATTCAAAA
GGCAGCAATAAGGCAGAGAAAGACGGTCCACCTAATGTTTCACTACATGCCTTTTATGTCATTGACAATGCAAAGAAAGAAGTTGAAGCTTCGTGTCCTGGTGTAGTTTCTTGTGCTGAT
ATTCTGGCTTTAGCTGCAAGAGATGCAGTTGCACTT
TCTGGAGGACCAACATGGGATGTGCCTAAGGGAAGAAAGGACGGGAGAACATCAAAGGCAAGTGAAACAATACAATTGCCAGCT
CCAACTTTTAACATCTCTCAGCTGCAACAAAGCTTCTCCCAAAGAGGCCTGTCCATGGATGATCTAGTGGCTCTTTCAG
GTGGGCACACTCTAGGTTTTTCCCACTGTTCGTCCTTCCGG
AACAGAATCCACAATTTTAATGCCACTCACGACATAGACCCAACTATGAATCCCTCATTCGCAGCAAGGTTAAAAAGTATTTGCCCTAAAAACAATAAGGCGAAGAATGCCGGTGCCCCC
ATGGACCCTTCCTCAACGACTTTTGATAACACGTATTTCAAGTTGATCCTCCAAGGAAAAAGCCTGTTCTCTTCAGACCAAGCTCTTCTCACAAGTACAGGGACTAAAGATTTAGTTTCC
AAGTTTGCTACCTCCAAAGATACTTTCTCAGAGGCATTTGTCAAATCTATGATCAGAATGAGCAGCATCACAGGTGGCCAGGAGGTTAGGAAGGACTGTAGGGTGGTAAAT

Retrieve as FASTA