Entry information : RcPrx16 (29613.m000380)
Entry ID 9346
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx16 (29613.m000380)
Name (synonym) RcPrx16 (29613.m000380)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx16
start..stop
S start..stop
MePrx53 557 0 5..335 3..334
PtPrx72 538 0 16..335 12..331
PbPrx72 538 0 16..335 12..331
PpePrx07 534 0 14..334 11..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 159369..159599 231 N° 2 159698..159889 192 N° 3 159983..160148 166 N° 4 160255..160670 416
join(159369..159599,159698..159889,159983..160148,160255..160670)


exon

Literature and cross-references RcPrx16 (29613.m000380)
DNA ref. Phytozome 12:   29613 (159369..160670)
Protein sequence: RcPrx16 (29613.m000380)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (305)
PWM (Da):   %s   34957.21 (32000.6)  
PI (pH):   %s   4.63 (4.60) Peptide Signal:   %s   cut: 31 range:31-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSASSKATATATSLLLSIIIAALVLNQSEAQLSTTFYASTCPNITSIVTNAVQQAFQSDSRIGASLIRLHFHDCFVDGCDASILLDSTSSIQSEKLAGPNVNSTRGFGVVDNIKTAAESSCPGVVSCADILALSAEASVSLSGGPSWNVLLGRRDSLTANQAGANTSIPSPFEGLNNITSKFTAVGLNTNDLVALSGAHTFGRAQCRTFNNRLFNFSNTGNPDPTLNTTYLATLQQICPQNGNTAALVNLDPTTPDTFDNNYFTNLQSNQGLLQSDQELFSTTGAATVSIVNSFAGNQTAFFQSFVQSMINMGNISPLTGSNGEIRADCKKVNG

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTTCTTCTAAAGCTACTGCTACTGCTACTTCCTTGTTACTGTCAATTATTATTGCAGCTCTAGTTCTGAACCAATCTGAAGCTCAACTAAGTACTACATTCTATGCTTCTACC
TGCCCAAATATTACATCCATTGTCACTAATGCTGTTCAACAGGCCTTTCAGTCTGATTCCCGGATTGGCGCTAGCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTGAT
GTATAGATC
CGCATCTCCTAATTCAATTTCCTCCAAAGAGTATTCCCAGAATTTGTATTATGTTATATAGTGTTGAATTTTGTTTCTTGATTTTCCAGGGTTGTGATGCGTCTATTTTGCTAGACAGCA
CTTCAAGCATACAGAGTGAGAAATTAGCTGGTCCTAACGTTAACTCCACTCGTGGTTTTGGTGTCGTTGACAATATAAAAACTGCTGCGGAAAGTTCTTGCCCCGGTGTAGTTTCCTGTG
CTGACATTCTTGCTCTCTCCGCAGAAGCTTCTGTTTCGTTG
GTAATTAGTAATTGTTAATTAACAGGATTTTCTTTTGCGAAAACTGCGTATTTGGATGATCAATATAAGATATGGGTTA
TGATTGCATTGCAGTCAGGAGGACCATCCTGGAATGTGTTATTGGGAAGAAGAGACAGTCTAACAGCAAATCAAGCTGGAGCAAATACATCTATTCCTTCTCCTTTTGAAGGACTAAACA
ACATTACTTCCAAGTTCACTGCTGTGGGTCTAAACACCAATGATCTCGTCGCATTATCAG
GTAATCACAAAGTTTTTGTTTTTGGGCTTAATTCAGTTTCAACTATGATTTGAATCAGGG
AATTCACGGTCTCGAATATCTAACTTTTTATATCTGAAATTTACAGGTGCACATACATTTGGACGTGCTCAATGTCGAACCTTTAACAACAGGCTATTCAATTTCAGCAACACTGGAAAT
CCTGACCCAACATTGAACACAACATACTTAGCCACTCTGCAACAAATATGTCCACAGAATGGGAATACAGCTGCTCTCGTCAATCTTGACCCCACAACTCCAGATACTTTTGACAATAAT
TACTTCACCAACTTGCAGAGTAATCAGGGCCTTCTCCAATCAGACCAGGAATTATTTTCGACAACCGGTGCTGCCACTGTATCTATTGTTAACAGCTTTGCTGGTAACCAGACTGCCTTC
TTCCAGAGTTTTGTGCAGTCTATGATTAATATGGGAAACATTAGTCCTTTAACAGGAAGCAATGGAGAGATAAGAGCAGACTGTAAGAAGGTCAATGGAAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTGCTTCTTCTAAAGCTACTGCTACTGCTACTTCCTTGTTACTGTCAATTATTATTGCAGCTCTAGTTCTGAACCAATCTGAAGCTCAACTAAGTACTACATTCTATGCTTCTACC
TGCCCAAATATTACATCCATTGTCACTAATGCTGTTCAACAGGCCTTTCAGTCTGATTCCCGGATTGGCGCTAGCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTGAT
GGTTGTGAT
GCGTCTATTTTGCTAGACAGCACTTCAAGCATACAGAGTGAGAAATTAGCTGGTCCTAACGTTAACTCCACTCGTGGTTTTGGTGTCGTTGACAATATAAAAACTGCTGCGGAAAGTTCT
TGCCCCGGTGTAGTTTCCTGTGCTGACATTCTTGCTCTCTCCGCAGAAGCTTCTGTTTCGTTG
TCAGGAGGACCATCCTGGAATGTGTTATTGGGAAGAAGAGACAGTCTAACAGCAAAT
CAAGCTGGAGCAAATACATCTATTCCTTCTCCTTTTGAAGGACTAAACAACATTACTTCCAAGTTCACTGCTGTGGGTCTAAACACCAATGATCTCGTCGCATTATCAG
GTGCACATACA
TTTGGACGTGCTCAATGTCGAACCTTTAACAACAGGCTATTCAATTTCAGCAACACTGGAAATCCTGACCCAACATTGAACACAACATACTTAGCCACTCTGCAACAAATATGTCCACAG
AATGGGAATACAGCTGCTCTCGTCAATCTTGACCCCACAACTCCAGATACTTTTGACAATAATTACTTCACCAACTTGCAGAGTAATCAGGGCCTTCTCCAATCAGACCAGGAATTATTT
TCGACAACCGGTGCTGCCACTGTATCTATTGTTAACAGCTTTGCTGGTAACCAGACTGCCTTCTTCCAGAGTTTTGTGCAGTCTATGATTAATATGGGAAACATTAGTCCTTTAACAGGA
AGCAATGGAGAGATAAGAGCAGACTGTAAGAAGGTCAATGGAAGT

Retrieve as FASTA