Entry information : RcPrx18 ( 29647.m002045)
Entry ID 9348
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-24 (Christophe Dunand)
Peroxidase information: RcPrx18 ( 29647.m002045)
Name (synonym) RcPrx18 ( 29647.m002045)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx18
start..stop
S start..stop
RcPrx88 628 0 1..325 1..322
MePrx73 546 0 1..325 1..323
MePrx130 540 0 1..325 1..323
MePrx66 532 0 1..325 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 354091..354300 210 N° 2 354572..354763 192 N° 3 354876..355044 169 N° 4 355312..355715 404
join(354091..354300,354572..354763,354876..355044,355312..355715)


exon

Literature and cross-references RcPrx18 ( 29647.m002045)
DNA ref. Phytozome 12:   29647 (354091..355715)
Protein sequence: RcPrx18 ( 29647.m002045)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (305)
PWM (Da):   %s   35632.34 (33453.2) Transmb domain:   %s   i5-23o
PI (pH):   %s   8.56 (8.57) Peptide Signal:   %s   cut: 21 range:21-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTVFLFCLLVLSVIGICQAGGLRKKFYRRSCPQAEDTIRKITEKHVLSNPNLPAKLLRMHFHDCFVRVRGCDGSILIESTTNSTAEKDSIPNLTLTGFDVIEDIKSELEKACPGLVSCADILALAARDSVSFQQFKKPLWEVLTGRRDGNVSLASEVFANIPSPFADFSTLKQNFKSKGLTVHDLVVLSGGHTIGVGHCNLFSNRLYNFTGKGDQDPSLSATYAEFLKAKCRSLADTTTTVEMDPDSSFTFDNDYFVILKQHKGLFQSDAALLTNKIASKIAGELLNSKAFFTEFAQSMKRMGAIEVLTGSKGEIRKKCSVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (Short PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTGTTTTTCTCTTTTGCTTGTTAGTTTTGAGTGTTATTGGCATTTGTCAAGCAGGTGGTTTGAGGAAGAAATTCTATAGAAGATCATGTCCTCAAGCAGAAGATACTATTCGG
AAGATCACTGAGAAACACGTTTTAAGCAATCCCAATTTACCTGCTAAGTTGTTGAGAATGCATTTTCATGACTGTTTTGTCAGGGTAAGA
CGTGCAAGTTTCTTCGTGAATGTATATCCA
AGCCAATCTTCTTTTATTTTCTCTTTTCATAGTATGATTAGTTTCACATTACCAATAAACTGAACAACAAGCGAAGTGCACTAATACATTGTTATTGACATAAAACTAACAGATCTTACC
CGTAGTAGAACTAGAGGGTTTTGGCTCTTGTGTTTTCTTAATGTGTATGAAGAAGTGCTCTTTTGACCTGATCTAATTATTTGTATGCATATGTTGAACACAATTATGTATTAAATTTCA
GGGGTGTGACGGTTCAATTTTAATAGAATCAACTACAAATAGCACTGCAGAGAAGGACTCAATTCCGAACCTTACTTTGACGGGGTTTGACGTTATTGAAGACATAAAATCGGAGCTAGA
GAAAGCATGTCCAGGACTTGTATCTTGTGCTGACATCTTGGCCTTGGCTGCTAGGGATTCGGTTTCTTTCCAG
GTATAATTCGCCATAAGCTCGAGTAATATATATATATATATATATTA
GATCCTACGCAAATGCAAATTATTATTTCATGTGCCTCGTAAGAAAATGCGTTTCCCTTTTGCATCAGTTCAAGAAACCACTATGGGAAGTGCTTACTGGGAGAAGAGATGGCAATGTTT
CACTAGCTTCCGAAGTCTTTGCTAATATTCCTTCGCCCTTTGCCGATTTCTCTACTCTTAAGCAAAACTTCAAAAGCAAGGGTCTCACAGTCCATGACCTAGTTGTACTATCGG
GTAAAT
ATACAATCACATTCAATTATCTATATATATATAGCATATGGTTGCAATTACTCATTACAGTTAACACTCCTGCGATAACTAATTAAGCAATAATATATACAAGCTACTTTAAACTTTATA
AAAATATAATATTTAACTAGTCATTATAAACTATTTATGTATTAATCTTTTTTGGACTGATTATTTCCTCCTAAGTTGCTTCCAGAAAATTAGACATTAATCCAATAAGAAACCATACGA
AATTTCTTTGAATGTTTGTAGGTGGACACACCATTGGAGTAGGACACTGCAATCTCTTCAGCAATAGGCTTTACAATTTCACAGGAAAAGGCGATCAAGACCCTTCCCTTAGCGCAACCT
ATGCGGAGTTCCTGAAGGCCAAATGTCGAAGTCTTGCCGACACGACAACCACAGTAGAGATGGATCCTGATAGCTCTTTCACATTTGATAACGATTACTTTGTTATTCTTAAGCAGCATA
AGGGTCTTTTCCAATCTGATGCAGCCCTTCTAACGAACAAGATTGCCAGTAAAATTGCTGGAGAGTTGCTTAATTCTAAAGCTTTCTTTACAGAGTTTGCTCAGTCAATGAAGAGGATGG
GAGCCATTGAAGTTCTTACTGGCTCTAAAGGAGAGATCAGGAAAAAGTGCAGTGTTGTTAATTCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTGTTTTTCTCTTTTGCTTGTTAGTTTTGAGTGTTATTGGCATTTGTCAAGCAGGTGGTTTGAGGAAGAAATTCTATAGAAGATCATGTCCTCAAGCAGAAGATACTATTCGG
AAGATCACTGAGAAACACGTTTTAAGCAATCCCAATTTACCTGCTAAGTTGTTGAGAATGCATTTTCATGACTGTTTTGTCAGGGTAAGA
GGGTGTGACGGTTCAATTTTAATAGAATCA
ACTACAAATAGCACTGCAGAGAAGGACTCAATTCCGAACCTTACTTTGACGGGGTTTGACGTTATTGAAGACATAAAATCGGAGCTAGAGAAAGCATGTCCAGGACTTGTATCTTGTGCT
GACATCTTGGCCTTGGCTGCTAGGGATTCGGTTTCTTTCCAG
CAGTTCAAGAAACCACTATGGGAAGTGCTTACTGGGAGAAGAGATGGCAATGTTTCACTAGCTTCCGAAGTCTTTGCT
AATATTCCTTCGCCCTTTGCCGATTTCTCTACTCTTAAGCAAAACTTCAAAAGCAAGGGTCTCACAGTCCATGACCTAGTTGTACTATCGG
GTGGACACACCATTGGAGTAGGACACTGC
AATCTCTTCAGCAATAGGCTTTACAATTTCACAGGAAAAGGCGATCAAGACCCTTCCCTTAGCGCAACCTATGCGGAGTTCCTGAAGGCCAAATGTCGAAGTCTTGCCGACACGACAACC
ACAGTAGAGATGGATCCTGATAGCTCTTTCACATTTGATAACGATTACTTTGTTATTCTTAAGCAGCATAAGGGTCTTTTCCAATCTGATGCAGCCCTTCTAACGAACAAGATTGCCAGT
AAAATTGCTGGAGAGTTGCTTAATTCTAAAGCTTTCTTTACAGAGTTTGCTCAGTCAATGAAGAGGATGGGAGCCATTGAAGTTCTTACTGGCTCTAAAGGAGAGATCAGGAAAAAGTGC
AGTGTTGTTAATTCT

Retrieve as FASTA