Entry information : RcPrx23 (29726.m003965)
Entry ID 9351
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx23 (29726.m003965)
Name (synonym) RcPrx23 (29726.m003965)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx23
start..stop
S start..stop
MePrx72 496 5e-179 1..326 1..325
MePrx86 495 2e-178 1..326 1..333
EgrPrx126 452 2e-161 24..325 21..326
NtPrx06-1B 452 3e-161 7..325 12..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 466164..466382 219 N° 2 465864..466052 189 N° 3 465601..465766 166 N° 4 465055..465458 404
complement(join(465055..465458,465601..465766,465864..466052,466164..466382))


exon

Literature and cross-references RcPrx23 (29726.m003965)
DNA ref. Phytozome 12:   29726 (466382..465055)
Protein sequence: RcPrx23 (29726.m003965)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (301)
PWM (Da):   %s   35198.83 (32732.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   5.72 (5.71) Peptide Signal:   %s   cut: 26 range:26-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMARDGILIAISSLLVLAAVGVSNADGLSLRFYNTSCPDAELIVRNITRNRAQSDSALGAKLLRMHFHDCFVRGCDASILLDAVGIQSEKDTIPNQSLSGFDVIDEIKTQLEQVCPGVVSCADILALASRDAVSLSFQKPLWDVLTGRRDGTVSLASEVNGNIPSPFADFNTLMQQFSNKGLDVNDLVVLSGGHTIGVAHCATFTNRLYNFTGIGDMDPSLDKTYAELLKTKCPNPSNPATTVEMDPQSSLTFDKNYYDILLQNKGLFQSDAALLENTQSARIVRQLKTSNAFFAKFAISMKKMGAIEVLTGNAGQIRQNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCTAGAGATGGTATATTGATTGCAATATCGTCACTTCTTGTTCTTGCAGCTGTTGGGGTTTCTAATGCTGATGGTTTGAGCCTGCGTTTCTACAACACAAGTTGCCCAGATGCT
GAGCTGATTGTGAGGAACATCACAAGGAATAGAGCTCAAAGTGACTCAGCTTTGGGTGCTAAACTTTTAAGAATGCACTTCCATGACTGTTTTGTTAGG
GTATATTTGCCTTAATCTATC
ATTATGCATGTATTCGTAAAGCTAGCAACATGTATATGTTATACTTATTGCATTTTAATTAACATTTTCTAACTGTATTATATGTGGCAGGGGTGCGATGCATCCATACTGTTGGATGCA
GTTGGAATTCAATCTGAGAAAGATACAATTCCTAATCAATCACTGTCAGGTTTCGATGTCATTGATGAAATTAAGACTCAACTCGAGCAAGTTTGCCCTGGAGTTGTTTCATGTGCAGAC
ATTCTGGCCTTGGCATCTCGTGATGCTGTTTCGTTATCG
GTAAGCAATTAGTCCTGACCAATTATATGCATATATATATATATATATTTCTCTTCATAATTATGCATGTAACATACAATA
TGCATGTTGATAGCAGTTCCAGAAGCCATTATGGGATGTCTTAACTGGAAGAAGGGATGGCACAGTTTCTCTAGCATCTGAAGTCAATGGAAACATTCCTTCCCCATTCGCAGATTTCAA
CACTCTCATGCAACAATTTTCCAACAAGGGTCTTGATGTCAATGACCTTGTGGTTCTCTCAG
GTTTGAATCAAAGATATTTTTAATTTTCATTCAAATTTGAAACTATGGCATTGATAAT
CATATAAATTATATATTTTGTAACGCTTTGTATCAAGATCTGATTGGTACCCGGCTGATACAGTTTGATTTAAATTTTGAGCAGGTGGACATACTATAGGTGTTGCTCACTGTGCCACAT
TTACAAATAGACTGTATAACTTCACAGGCATTGGAGATATGGATCCTTCTCTAGATAAAACCTATGCAGAGTTGTTGAAAACCAAATGTCCGAATCCATCAAATCCAGCAACAACTGTGG
AGATGGATCCTCAAAGCTCACTCACATTTGACAAGAATTACTACGATATTCTTCTTCAAAACAAGGGCCTTTTTCAGTCTGATGCTGCATTACTCGAAAATACACAATCTGCCAGGATAG
TTCGACAGCTGAAGACATCAAATGCCTTTTTCGCTAAGTTTGCTATATCGATGAAGAAAATGGGAGCTATTGAAGTGCTTACAGGAAATGCTGGACAGATCAGGCAGAACTGCCGTGTAG
TAAATCCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGCTAGAGATGGTATATTGATTGCAATATCGTCACTTCTTGTTCTTGCAGCTGTTGGGGTTTCTAATGCTGATGGTTTGAGCCTGCGTTTCTACAACACAAGTTGCCCAGATGCT
GAGCTGATTGTGAGGAACATCACAAGGAATAGAGCTCAAAGTGACTCAGCTTTGGGTGCTAAACTTTTAAGAATGCACTTCCATGACTGTTTTGTTAGG
GGGTGCGATGCATCCATACTG
TTGGATGCAGTTGGAATTCAATCTGAGAAAGATACAATTCCTAATCAATCACTGTCAGGTTTCGATGTCATTGATGAAATTAAGACTCAACTCGAGCAAGTTTGCCCTGGAGTTGTTTCA
TGTGCAGACATTCTGGCCTTGGCATCTCGTGATGCTGTTTCGTTATCG
TTCCAGAAGCCATTATGGGATGTCTTAACTGGAAGAAGGGATGGCACAGTTTCTCTAGCATCTGAAGTCAAT
GGAAACATTCCTTCCCCATTCGCAGATTTCAACACTCTCATGCAACAATTTTCCAACAAGGGTCTTGATGTCAATGACCTTGTGGTTCTCTCAG
GTGGACATACTATAGGTGTTGCTCAC
TGTGCCACATTTACAAATAGACTGTATAACTTCACAGGCATTGGAGATATGGATCCTTCTCTAGATAAAACCTATGCAGAGTTGTTGAAAACCAAATGTCCGAATCCATCAAATCCAGCA
ACAACTGTGGAGATGGATCCTCAAAGCTCACTCACATTTGACAAGAATTACTACGATATTCTTCTTCAAAACAAGGGCCTTTTTCAGTCTGATGCTGCATTACTCGAAAATACACAATCT
GCCAGGATAGTTCGACAGCTGAAGACATCAAATGCCTTTTTCGCTAAGTTTGCTATATCGATGAAGAAAATGGGAGCTATTGAAGTGCTTACAGGAAATGCTGGACAGATCAGGCAGAAC
TGCCGTGTAGTAAATCCA

Retrieve as FASTA