Entry information : RcPrx24 (29726.m003966)
Entry ID 9352
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx24 (29726.m003966)
Name (synonym) RcPrx24 (29726.m003966)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx24
start..stop
S start..stop
MePrx105 469 1e-167 19..348 24..344
VvPrx[P]60 415 2e-146 42..348 19..326
PpePrx41 388 1e-135 58..348 36..327
RcPrx23 384 5e-134 58..348 36..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 474777..475061 285 N° 2 474451..474642 192 N° 3 474115..474280 166 N° 4 473545..473945 401
complement(join(473545..473945,474115..474280,474451..474642,474777..475061))


exon

Literature and cross-references RcPrx24 (29726.m003966)
DNA ref. Phytozome 11:   29726 (475061..473545)
Protein sequence: RcPrx24 (29726.m003966)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (323)
PWM (Da):   %s   37771.09 (34955.5)  
PI (pH):   %s   7.82 (7.57) Peptide Signal:   %s   cut: 26 range:26-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRNYNIILLYLSLLLLAGLDVSNGKGGGHGRDDHDQQNGRGHGHGSDKQHGGKKVNSCPQLETISRDITWGRVASNPTLPAKLIRMHFHDCFVRGCDASILLDSTGNTKAEKEAIPNRSLTGFDVIDDIKAKLEEECPGQISCADIIALAARDAVSFQFGRPLWPVAFGRKDGRISLESEATRDLPSPAADFKTLLSQFRSHGLDVTDLVALSGAHTIGVGHCVIIAKRLFNFTGIGDTDPSLDKNYADFLKKQCSNPPNPTTTVEMDPGSSLSFDTNYFVAINHKKGLFQSDAALLTNPEAARLSSNFENPNVFFPRFAQSMVKMGSIGVLTGKQGEIRKNCHFV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is incorrectly predicted).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCGTAACTATAACATCATTCTCCTATACCTTTCTCTCTTGTTGCTCGCGGGTCTTGATGTGTCGAATGGAAAAGGTGGAGGCCATGGCCGTGACGACCATGATCAGCAAAACGGT
CGAGGGCACGGGCATGGTTCAGATAAGCAACATGGAGGCAAAAAAGTGAACAGTTGCCCTCAACTTGAAACAATTTCAAGGGACATTACATGGGGGAGGGTTGCATCTAACCCTACCTTG
CCAGCCAAGCTAATAAGAATGCACTTCCACGATTGTTTTGTTAGA
GTATGATCCATTTGCACTTAATATGAACTTTCCGCAGCATCATGATGCGCATTCAATGCAGTTTATACCGACGCA
TGTGCACCATGTCTTCTTTTATATTCCTTAATTGAATTATAAATATTTTGTCGTTTTAGGGCTGTGATGCATCAATACTGTTGGATTCGACCGGTAATACTAAAGCTGAGAAAGAAGCAA
TACCGAACAGATCTCTAACAGGATTTGATGTTATTGATGACATAAAAGCTAAATTAGAAGAGGAATGCCCTGGGCAGATCTCATGTGCTGATATTATTGCCTTGGCAGCAAGAGATGCTG
TTTCTTTCCAA
GTAAGATTACTGTCATAATAGCTAGTCATGCAAGTAATGAATAGAAAATGTATTGATCACACCTGATGACAAAAAAAAAATTCAGACCATATTGGAAATTTGCAATATA
AATAGAAGAATCTTGTGTATGAATAAATATTTATAGGAATGTTGTGGTTGCGATTATGCAGTTTGGAAGACCATTATGGCCTGTTGCTTTTGGAAGGAAAGATGGAAGAATTTCATTGGA
ATCTGAGGCTACTAGAGATTTACCATCCCCTGCAGCTGACTTCAAAACTCTTCTTTCACAATTTCGAAGCCATGGACTAGATGTTACGGATCTTGTTGCTTTATCAG
GTAACTAGTCCTT
TCATATTTTTTTTTTTATTTCATTTAAATTGCTAAAGTTTAAACTCCAAATTTTCTCCACTGTGTATACAGATGCTCCACTATTAAACTATTAGTCTGTTGATTACATAATATAATGTGA
TCTCACTAACAGGAAAATGAGATACATGTTTTGCAGGGGCTCACACTATTGGAGTAGGGCACTGTGTAATTATTGCAAAGAGACTCTTCAATTTCACAGGAATAGGGGACACAGATCCTT
CGCTTGATAAAAACTATGCAGATTTCTTGAAAAAGCAATGCTCCAACCCTCCTAATCCTACTACAACAGTAGAGATGGATCCTGGAAGTTCACTCTCCTTTGACACCAATTACTTTGTTG
CTATAAACCACAAAAAGGGCTTGTTTCAATCAGACGCAGCTTTACTCACTAACCCTGAAGCAGCACGGTTAAGCAGCAATTTCGAAAACCCAAATGTTTTCTTTCCTCGCTTTGCTCAAT
CAATGGTAAAAATGGGTTCCATTGGTGTACTTACAGGAAAGCAAGGAGAAATTAGGAAGAACTGCCATTTTGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGCGTAACTATAACATCATTCTCCTATACCTTTCTCTCTTGTTGCTCGCGGGTCTTGATGTGTCGAATGGAAAAGGTGGAGGCCATGGCCGTGACGACCATGATCAGCAAAACGGT
CGAGGGCACGGGCATGGTTCAGATAAGCAACATGGAGGCAAAAAAGTGAACAGTTGCCCTCAACTTGAAACAATTTCAAGGGACATTACATGGGGGAGGGTTGCATCTAACCCTACCTTG
CCAGCCAAGCTAATAAGAATGCACTTCCACGATTGTTTTGTTAGA
GGCTGTGATGCATCAATACTGTTGGATTCGACCGGTAATACTAAAGCTGAGAAAGAAGCAATACCGAACAGATCT
CTAACAGGATTTGATGTTATTGATGACATAAAAGCTAAATTAGAAGAGGAATGCCCTGGGCAGATCTCATGTGCTGATATTATTGCCTTGGCAGCAAGAGATGCTGTTTCTTTCCAA
TTT
GGAAGACCATTATGGCCTGTTGCTTTTGGAAGGAAAGATGGAAGAATTTCATTGGAATCTGAGGCTACTAGAGATTTACCATCCCCTGCAGCTGACTTCAAAACTCTTCTTTCACAATTT
CGAAGCCATGGACTAGATGTTACGGATCTTGTTGCTTTATCAG
GGGCTCACACTATTGGAGTAGGGCACTGTGTAATTATTGCAAAGAGACTCTTCAATTTCACAGGAATAGGGGACACA
GATCCTTCGCTTGATAAAAACTATGCAGATTTCTTGAAAAAGCAATGCTCCAACCCTCCTAATCCTACTACAACAGTAGAGATGGATCCTGGAAGTTCACTCTCCTTTGACACCAATTAC
TTTGTTGCTATAAACCACAAAAAGGGCTTGTTTCAATCAGACGCAGCTTTACTCACTAACCCTGAAGCAGCACGGTTAAGCAGCAATTTCGAAAACCCAAATGTTTTCTTTCCTCGCTTT
GCTCAATCAATGGTAAAAATGGGTTCCATTGGTGTACTTACAGGAAAGCAAGGAGAAATTAGGAAGAACTGCCATTTTGTTAAT

Retrieve as FASTA