Entry information : RcPrx27 (29729.m002333)
Entry ID 9355
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx27 (29729.m002333)
Name (synonym) RcPrx27 (29729.m002333)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx27
start..stop
S start..stop
MePrx27 570 0 1..318 1..326
EtPrx01 545 0 1..306 1..305
MePrx26 536 0 1..318 1..326
PtPrx68 527 0 1..318 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 365845..366057 213 N° 2 366509..366700 192 N° 3 366797..366962 166 N° 4 367199..367581 383
join(365845..366057,366509..366700,366797..366962,367199..367581)


exon

Literature and cross-references RcPrx27 (29729.m002333)
DNA ref. Phytozome 12:   29729 (365845..367581)
Protein sequence: RcPrx27 (29729.m002333)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (294)
PWM (Da):   %s   34047.1 (31449.7)  
PI (pH):   %s   8.58 (8.40) Peptide Signal:   %s   cut: 25 range:25-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSSFFRTIVTLSLLLVVSISNAQLSTNFYSKSCPNLFSTVKPVVQSAINQEKRMGASLVRLFFHDCFVNGCDGSILLDDTSSFTGEQTAVPNRNSVRGFEVIDSIKSAVEKACPGVVSCADILAIAARDSTAILGGPSWNVKLGRRDARTASLSAANNGIPAPTSNLNQLISRFSALGLSTRDLVALSGAHTIGQARCTNFRTRIYNDTNIDSSFAQTRRSNCPSTGGDNNLAPLDLQTPTSFDNNYFKNLLVQKGLLHSDQELFNNGSTDSIVRTYSNGQSTFFSDFVAGMIKMGDISPLTGSQGEIRKNCGKV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTTCATCATTTTTCAGAACTATTGTCACTTTGTCTCTGCTCCTTGTTGTGAGTATAAGCAACGCTCAACTCTCCACAAACTTCTACTCCAAATCTTGCCCGAACCTTTTTTCG
ACTGTGAAACCTGTTGTTCAATCAGCCATTAATCAGGAGAAGCGAATGGGTGCATCCCTGGTTCGCTTGTTCTTCCACGACTGCTTTGTTAAT
GTAATTCTTCTTTTTGTTTTATTAGCT
ATAAACTCGCCCACCCATATTCATCTTACATAATTTGTAATTGAAAGTTAACTTATTTTGGAAGTTAATATTTAATTAATTAGGCCGAGCTTAATCGGTACTAAAATTATTTCTAAAATC
GTGGGGTCTTAAATTAGAATCTAGTCTTACCCAATTTGTCGTTGAGTTGAATTTAGCCTTAAGTAGTTGTGTTTGCATGTAAAGGTCAACAAAAACGTCTATCAAAAGACCTATGTCTAA
ATGCATTGACATGAAACACATTGATTTATATCAAGGCTAGTATGTTATTATATTGTAATTTTCCTGGTGATCGTGGCTTAATGGATTACTGTTGGACCTACCTTCTCTTAGTTTGTTTTT
CGTTTTATACCATATGATTATTAAACTATTATTCTTATTGTTCTTTGTTGTCTTTTCATGACAGGGATGTGATGGTTCAATTCTACTTGATGACACATCTTCCTTCACTGGAGAGCAAAC
TGCAGTTCCTAACAGGAATTCTGTAAGAGGATTTGAGGTGATTGACAGCATAAAATCTGCTGTTGAGAAGGCTTGCCCTGGTGTAGTCTCATGTGCTGATATCTTAGCTATTGCTGCTAG
AGACTCCACTGCTATT
GTAAGTTCCGTTTTTCTATATGATTCAATTATATATATATGCATCAATCCAGTACATAATCAAATACGGGTTTTTTCTTGACATGTTGATTATTAGCTTGGAGG
TCCAAGCTGGAATGTTAAACTTGGAAGAAGAGATGCTAGAACTGCAAGCCTTTCTGCTGCCAATAATGGCATTCCAGCTCCAACTTCTAACTTGAACCAACTCATCTCAAGATTTAGTGC
TCTTGGCCTTTCAACTAGAGACTTGGTTGCTTTATCTG
GTTACTCCTCTGTCTCTCTCTCTCTAATTAAATAGTCAAAAATCATTTTTCTCTTTAGCAACAATTCAATCTTCTTTTATAT
ATATCAGCATGTTTTACTTTCTTTAATTTTCTAACAACACATCCTTATCTGACCATCTTAATATGCACCAAAGATTTGATTGAATCACATGTGGTTCTGTTTTTTAGTGGGATTATCTTC
TTGACTTAGTTTTATTATCATGCAATAAATATAGGAGCCCACACAATCGGACAAGCAAGGTGCACAAATTTTAGGACAAGGATATACAATGACACCAACATAGACAGTTCTTTTGCTCAA
ACAAGAAGATCAAACTGCCCAAGTACAGGTGGCGACAACAACTTAGCACCACTTGATTTGCAGACTCCTACATCTTTCGACAACAACTACTTCAAGAACTTGCTCGTCCAAAAAGGCTTA
CTTCACTCTGATCAAGAATTGTTCAATAATGGATCAACCGATTCAATAGTTCGCACATACAGCAATGGCCAGAGTACCTTCTTTTCTGATTTTGTTGCTGGCATGATCAAGATGGGAGAC
ATTAGCCCACTTACTGGATCACAAGGGGAGATCAGAAAGAATTGTGGGAAGGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTTTCATCATTTTTCAGAACTATTGTCACTTTGTCTCTGCTCCTTGTTGTGAGTATAAGCAACGCTCAACTCTCCACAAACTTCTACTCCAAATCTTGCCCGAACCTTTTTTCG
ACTGTGAAACCTGTTGTTCAATCAGCCATTAATCAGGAGAAGCGAATGGGTGCATCCCTGGTTCGCTTGTTCTTCCACGACTGCTTTGTTAAT
GGATGTGATGGTTCAATTCTACTTGAT
GACACATCTTCCTTCACTGGAGAGCAAACTGCAGTTCCTAACAGGAATTCTGTAAGAGGATTTGAGGTGATTGACAGCATAAAATCTGCTGTTGAGAAGGCTTGCCCTGGTGTAGTCTCA
TGTGCTGATATCTTAGCTATTGCTGCTAGAGACTCCACTGCTATT
CTTGGAGGTCCAAGCTGGAATGTTAAACTTGGAAGAAGAGATGCTAGAACTGCAAGCCTTTCTGCTGCCAATAAT
GGCATTCCAGCTCCAACTTCTAACTTGAACCAACTCATCTCAAGATTTAGTGCTCTTGGCCTTTCAACTAGAGACTTGGTTGCTTTATCTG
GAGCCCACACAATCGGACAAGCAAGGTGC
ACAAATTTTAGGACAAGGATATACAATGACACCAACATAGACAGTTCTTTTGCTCAAACAAGAAGATCAAACTGCCCAAGTACAGGTGGCGACAACAACTTAGCACCACTTGATTTGCAG
ACTCCTACATCTTTCGACAACAACTACTTCAAGAACTTGCTCGTCCAAAAAGGCTTACTTCACTCTGATCAAGAATTGTTCAATAATGGATCAACCGATTCAATAGTTCGCACATACAGC
AATGGCCAGAGTACCTTCTTTTCTGATTTTGTTGCTGGCATGATCAAGATGGGAGACATTAGCCCACTTACTGGATCACAAGGGGAGATCAGAAAGAATTGTGGGAAGGTTAAT

Retrieve as FASTA