Entry information : RcPrx31 (29780.m001327)
Entry ID 9359
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx31 (29780.m001327)
Name (synonym) RcPrx31 (29780.m001327)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx31
start..stop
S start..stop
MePrx117 532 0 1..335 1..333
PpePrx08 492 8e-177 1..335 1..332
CpapPrx45 491 2e-176 1..335 1..342
CroPrx12 486 2e-174 1..335 1..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 125652..125891 240 N° 2 126362..126553 192 N° 3 126638..126803 166 N° 4 127333..127754 422
join(125652..125891,126362..126553,126638..126803,127333..127754)


exon

Literature and cross-references RcPrx31 (29780.m001327)
DNA ref. Phytozome 12:   29780 (125652..127754)
Protein sequence: RcPrx31 (29780.m001327)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (315)
PWM (Da):   %s   37245.54 (34468.0) Transmb domain:   %s   i5-24o
PI (pH):   %s   6.98 (6.27) Peptide Signal:   %s   cut: 26 range:26-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHKLFSHFTVPFFLILALSIPVAPFRPTAYGQQLDYNFYDQSCPRLEMIVKYGVWAALRNDSRMAASLLRLHFHDCFVNGCDGSILLDDTKKFQGEKNALPNRNSARGFEVIDSIKEDVERACPFTVSCADILALAAREAVLQSGGPFWSVPLGRRDGLTASQKAANENLPIPFESLENITAKFVAQGLDLKDVVVLSGAHTLGFAQCFTFKNRLFNFKGSGMPDPGLDSSALKNLQSMCPNKDASNRDLVPLDSASAYRFDNSYFTNLVTNTGLLESDQALMTDSRTAALVNSYSSYPYLFSSDFAASMVKMGSVGVLTGEQGQIRRKCGSVNYGWH

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACAAACTATTTTCACACTTCACTGTTCCCTTCTTTCTGATATTGGCTTTGAGTATTCCAGTCGCTCCTTTCCGGCCTACTGCTTATGGCCAGCAACTTGACTATAATTTCTAC
GACCAGTCATGCCCTCGTTTGGAAATGATTGTTAAGTATGGTGTTTGGGCAGCTTTGAGGAATGACTCCAGGATGGCTGCATCCCTCCTGCGGTTGCACTTCCATGATTGTTTTGTTAAT
GTAAATTATTGTTCTTAATCTTATGCTCTCATAGATGACATGATAGAAACATTAATTTGGTAAAACTAGTTAAAAGTAACTGTTAGCCTGTGTCAGATATCCTGATGAGAGGACGTCGCC
ATCAAGCAACCTTTTAGGTGCTTTAGGAGTGCGAGATTGCCTCATGAGAGGACGTCGCCCATCATGCACTAAGAAGATTTCGACTTGACACCTTTATAATAAATTTTTTGAGGTGCTCTA
GTAGAGCTTGATTAGGAGCCCCATTAGGCGATCAAAATCCTCCTTATTCTTATGCCTAATGAGTAACAGTAGGAGGTTAGGCCGAGCCCATATGCTTGCTCAGTGGCACAGAACTAACGT
CTTGCTTGATTTAAGATCTATCTCTTGGCAAATTTTAAGATCCATTTTTTTGCAGTATATATATCTATCATAGCTTAATTTACAACAGGTGCATCTGCTCTTTGGTATAGGGTTGCGATG
GGTCGATACTTCTTGATGACACAAAGAAATTTCAGGGAGAAAAGAATGCTCTTCCGAACCGCAACTCAGCTAGAGGATTCGAAGTGATTGACAGTATCAAAGAGGATGTTGAAAGAGCTT
GTCCGTTCACTGTTTCGTGTGCTGATATATTAGCTCTTGCAGCAAGAGAAGCTGTCTTGCAG
GTAATCAACATGCTCATGAATCTTCTCAACGCTTCTGTTTATTGTTGTATATTCTTGC
TTATTTTCTTCATTTCTGTGGTTCAGTCTGGTGGGCCTTTTTGGTCTGTTCCATTAGGCCGGCGCGATGGATTGACTGCAAGTCAGAAGGCAGCTAATGAAAACTTGCCTATTCCTTTTG
AGTCGCTAGAAAACATCACTGCTAAGTTCGTAGCTCAGGGCCTTGACTTAAAGGATGTTGTAGTCCTCTCAG
GTTCATGTTCTTCGCCCTATTTGCTCATTTTAATTGCTTCAAAAATAG
AACTCGAAATAAGAATAATGCTTAATTCAAAAGGAAAATTTATGTTTATGTTTTCATTTATAATCACACCAATTATATTGATATTTATTTATTAATTTTAATTAATTTAATAATATATCG
ATCATTAAATTTTTAAAATGTAAAACAAACATGTATATATACAGTGGATAAAAAATAATAATTTTAAAGTAATGGAGTGATTGCAATAAATGGCCGCACATCATCTGCATAGATTCTCAA
TACTCAAAACCATAATAACTACTATATTGCCAATTTTATCCTTCCTTATTAAAAGGACAAACTTGATTAATTTTACATGGAAACAAAAACAAAAGACTAAAATTTATGAGAGGATTGAAG
ACTAAAAGTATATGCATATGACTCTCCTCAAAATCTGATAATTAAAACTGGAACTATTTCTGACCACAATGTATAAAAAGCAATGCGCAACAATAGTGACGTTTATTTCTGAATGGTACA
GGAGCACATACCCTAGGTTTTGCTCAGTGCTTCACCTTCAAGAACAGGCTATTTAACTTCAAAGGCTCTGGCATGCCTGATCCTGGACTTGATTCTTCAGCACTGAAGAACTTGCAAAGT
ATGTGTCCTAACAAAGATGCATCAAACAGGGATCTAGTTCCTCTTGACTCCGCAAGTGCTTATAGATTTGACAATTCATATTTTACCAACCTTGTGACCAATACTGGCCTTCTTGAATCT
GATCAAGCTCTAATGACAGATTCAAGAACAGCTGCATTGGTCAACTCCTATAGTTCATACCCTTATCTTTTCTCCAGCGATTTTGCAGCATCAATGGTGAAGATGGGTAGTGTGGGGGTA
CTAACAGGAGAACAAGGGCAAATTAGAAGGAAATGCGGGTCTGTAAACTACGGATGGCATATG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCACAAACTATTTTCACACTTCACTGTTCCCTTCTTTCTGATATTGGCTTTGAGTATTCCAGTCGCTCCTTTCCGGCCTACTGCTTATGGCCAGCAACTTGACTATAATTTCTAC
GACCAGTCATGCCCTCGTTTGGAAATGATTGTTAAGTATGGTGTTTGGGCAGCTTTGAGGAATGACTCCAGGATGGCTGCATCCCTCCTGCGGTTGCACTTCCATGATTGTTTTGTTAAT
GGTTGCGATGGGTCGATACTTCTTGATGACACAAAGAAATTTCAGGGAGAAAAGAATGCTCTTCCGAACCGCAACTCAGCTAGAGGATTCGAAGTGATTGACAGTATCAAAGAGGATGTT
GAAAGAGCTTGTCCGTTCACTGTTTCGTGTGCTGATATATTAGCTCTTGCAGCAAGAGAAGCTGTCTTGCAG
TCTGGTGGGCCTTTTTGGTCTGTTCCATTAGGCCGGCGCGATGGATTG
ACTGCAAGTCAGAAGGCAGCTAATGAAAACTTGCCTATTCCTTTTGAGTCGCTAGAAAACATCACTGCTAAGTTCGTAGCTCAGGGCCTTGACTTAAAGGATGTTGTAGTCCTCTCAG
GA
GCACATACCCTAGGTTTTGCTCAGTGCTTCACCTTCAAGAACAGGCTATTTAACTTCAAAGGCTCTGGCATGCCTGATCCTGGACTTGATTCTTCAGCACTGAAGAACTTGCAAAGTATG
TGTCCTAACAAAGATGCATCAAACAGGGATCTAGTTCCTCTTGACTCCGCAAGTGCTTATAGATTTGACAATTCATATTTTACCAACCTTGTGACCAATACTGGCCTTCTTGAATCTGAT
CAAGCTCTAATGACAGATTCAAGAACAGCTGCATTGGTCAACTCCTATAGTTCATACCCTTATCTTTTCTCCAGCGATTTTGCAGCATCAATGGTGAAGATGGGTAGTGTGGGGGTACTA
ACAGGAGAACAAGGGCAAATTAGAAGGAAATGCGGGTCTGTAAACTACGGATGGCATATG

Retrieve as FASTA