Entry information : RcPrx33 (29780.m001334)
Entry ID 9361
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx33 (29780.m001334)
Name (synonym) RcPrx33 (29780.m001334)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx33
start..stop
S start..stop
RcPrx35 639 0 1..325 1..325
RcPrx36 541 0 1..324 1..326
RcPrx34 541 0 1..324 1..325
RcPrx37 526 0 13..324 12..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 192106..192339 234 N° 2 191827..192018 192 N° 3 191543..191708 166 N° 4 191061..191443 383
complement(join(191061..191443,191543..191708,191827..192018,192106..192339))


exon

Literature and cross-references RcPrx33 (29780.m001334)
DNA ref. Phytozome 11:   29780 (192339..191061)
Protein sequence: RcPrx33 (29780.m001334)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   35329.11 (32064.4)  
PI (pH):   %s   10.11 (10.15) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
METSTSKFFLSPAKAAAIMLILLLLNTACNAQLNSKFYDKTCAKALSTIRTSIRTAIARERRMAASLIRLHFHDCFVQGCDASILLDETSSMQSEKSALPNKDSARGYEVIDKAKSAVEKICPGVVSCADILAVAARDASAYVGGPSWTVRLGRRDSKTASRTLANRDLPSFRDGLDRLISRFRSKGLSARDMVALSGSHTLGQAQCFTFRERIYSNGTKIEGGFASTRRRRCPAVGGDANLAALDLVTPNSFDNNYFKNLIQKKGLLQSDQVLFSGGSTDSIVLEYSKNRETFNSDFATAMVKMGNLINPSRGEIRRICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAACTTCAACTTCCAAATTCTTTCTATCTCCAGCAAAAGCAGCAGCTATCATGTTAATATTGCTGCTTTTGAACACTGCATGCAACGCTCAACTCAACTCCAAGTTTTATGACAAA
ACATGTGCAAAAGCACTCTCTACTATCAGAACTTCCATCAGAACTGCTATTGCCAGAGAACGTAGAATGGCCGCATCTCTCATTCGCCTGCATTTTCATGACTGCTTTGTTCAG
GTACCC
TTTTATCCCCATGCAATTGCTACATGCATTCCTATTAAGCTTACGTTAGTCTCATGTTGGAACTAAACTTGGGTTTTGCAGGGTTGTGATGCCTCAATCTTACTGGATGAGACTTCATCC
ATGCAGAGTGAAAAGTCTGCACTTCCCAATAAGGATTCTGCTAGAGGTTATGAAGTCATCGACAAAGCGAAATCTGCAGTGGAGAAGATATGTCCTGGAGTTGTTTCCTGCGCTGATATC
CTTGCTGTTGCAGCAAGAGATGCATCTGCCTAT
GTAAGTATAAATATGTGTTCTTTGAGATGCCAATTTCGACATTCGAATCTAGTGAATCAAGCTAATTAAAATGTCAATATCAATCAT
GTATATATATACTTGTTTTTGTATAAATCAGGTCGGTGGTCCATCCTGGACTGTGAGGCTTGGAAGAAGGGATTCAAAGACTGCAAGTAGAACCCTAGCCAACAGGGACCTTCCTAGTTT
TAGAGATGGCCTCGACAGACTTATATCTCGCTTCCGAAGCAAAGGCCTAAGTGCTCGGGACATGGTTGCTTTGTCAG
GTTGGAGCTTGGAACTGTTCTAAGAGCCTGGCAGACCTAGTTA
ATAGCTTATATATTTCTGGTTCATGATGCTAAAATTGTTTATTTCGCCGAATGCAGGTTCCCATACTCTAGGACAAGCTCAATGCTTTACATTTCGCGAAAGGATATACAGCAATGGCAC
TAAAATTGAAGGTGGATTCGCTAGCACTCGCAGACGCCGTTGTCCTGCTGTCGGGGGCGATGCAAATTTAGCTGCACTCGATCTAGTCACACCCAATTCCTTCGACAACAATTACTTCAA
GAATTTGATACAAAAGAAAGGTCTTCTTCAATCTGATCAAGTTCTTTTCAGCGGAGGTTCTACGGACAGCATTGTGTTGGAGTATAGCAAAAATCGTGAAACTTTCAATTCAGATTTCGC
AACTGCCATGGTCAAGATGGGAAATCTTATCAACCCATCTCGTGGTGAAATAAGGAGAATCTGCAGTGCTGTCAACAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAACTTCAACTTCCAAATTCTTTCTATCTCCAGCAAAAGCAGCAGCTATCATGTTAATATTGCTGCTTTTGAACACTGCATGCAACGCTCAACTCAACTCCAAGTTTTATGACAAA
ACATGTGCAAAAGCACTCTCTACTATCAGAACTTCCATCAGAACTGCTATTGCCAGAGAACGTAGAATGGCCGCATCTCTCATTCGCCTGCATTTTCATGACTGCTTTGTTCAG
GGTTGT
GATGCCTCAATCTTACTGGATGAGACTTCATCCATGCAGAGTGAAAAGTCTGCACTTCCCAATAAGGATTCTGCTAGAGGTTATGAAGTCATCGACAAAGCGAAATCTGCAGTGGAGAAG
ATATGTCCTGGAGTTGTTTCCTGCGCTGATATCCTTGCTGTTGCAGCAAGAGATGCATCTGCCTAT
GTCGGTGGTCCATCCTGGACTGTGAGGCTTGGAAGAAGGGATTCAAAGACTGCA
AGTAGAACCCTAGCCAACAGGGACCTTCCTAGTTTTAGAGATGGCCTCGACAGACTTATATCTCGCTTCCGAAGCAAAGGCCTAAGTGCTCGGGACATGGTTGCTTTGTCAG
GTTCCCAT
ACTCTAGGACAAGCTCAATGCTTTACATTTCGCGAAAGGATATACAGCAATGGCACTAAAATTGAAGGTGGATTCGCTAGCACTCGCAGACGCCGTTGTCCTGCTGTCGGGGGCGATGCA
AATTTAGCTGCACTCGATCTAGTCACACCCAATTCCTTCGACAACAATTACTTCAAGAATTTGATACAAAAGAAAGGTCTTCTTCAATCTGATCAAGTTCTTTTCAGCGGAGGTTCTACG
GACAGCATTGTGTTGGAGTATAGCAAAAATCGTGAAACTTTCAATTCAGATTTCGCAACTGCCATGGTCAAGATGGGAAATCTTATCAACCCATCTCGTGGTGAAATAAGGAGAATCTGC
AGTGCTGTCAACAAG

Retrieve as FASTA